ID: 1029156685

View in Genome Browser
Species Human (GRCh38)
Location 7:98522226-98522248
Sequence CCAGCTGCACAGAGGGCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029156685_1029156691 -4 Left 1029156685 7:98522226-98522248 CCTAGTGCCCTCTGTGCAGCTGG No data
Right 1029156691 7:98522245-98522267 CTGGTAGATCTCTGGGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029156685 Original CRISPR CCAGCTGCACAGAGGGCACT AGG (reversed) Intergenic
No off target data available for this crispr