ID: 1029161055

View in Genome Browser
Species Human (GRCh38)
Location 7:98552213-98552235
Sequence TCTGGACACCAAGGCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029161052_1029161055 -10 Left 1029161052 7:98552200-98552222 CCTCAATAAAAACTCTGGACACC 0: 19
1: 52
2: 138
3: 200
4: 405
Right 1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG No data
1029161050_1029161055 4 Left 1029161050 7:98552186-98552208 CCTATGTAATGAAACCTCAATAA 0: 6
1: 30
2: 136
3: 336
4: 750
Right 1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029161055 Original CRISPR TCTGGACACCAAGGCTCAGG TGG Intergenic
No off target data available for this crispr