ID: 1029162375

View in Genome Browser
Species Human (GRCh38)
Location 7:98561789-98561811
Sequence TTGGTGGTAGAGCCAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029162375_1029162383 9 Left 1029162375 7:98561789-98561811 CCTCCCACTGGCTCTACCACCAA No data
Right 1029162383 7:98561821-98561843 GACTGAGTCAGGTACCAGCAAGG No data
1029162375_1029162382 -2 Left 1029162375 7:98561789-98561811 CCTCCCACTGGCTCTACCACCAA No data
Right 1029162382 7:98561810-98561832 AAAGGGAGATTGACTGAGTCAGG No data
1029162375_1029162384 17 Left 1029162375 7:98561789-98561811 CCTCCCACTGGCTCTACCACCAA No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029162375 Original CRISPR TTGGTGGTAGAGCCAGTGGG AGG (reversed) Intergenic