ID: 1029162376

View in Genome Browser
Species Human (GRCh38)
Location 7:98561792-98561814
Sequence CCTTTGGTGGTAGAGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029162376_1029162382 -5 Left 1029162376 7:98561792-98561814 CCCACTGGCTCTACCACCAAAGG No data
Right 1029162382 7:98561810-98561832 AAAGGGAGATTGACTGAGTCAGG No data
1029162376_1029162383 6 Left 1029162376 7:98561792-98561814 CCCACTGGCTCTACCACCAAAGG No data
Right 1029162383 7:98561821-98561843 GACTGAGTCAGGTACCAGCAAGG No data
1029162376_1029162384 14 Left 1029162376 7:98561792-98561814 CCCACTGGCTCTACCACCAAAGG No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029162376 Original CRISPR CCTTTGGTGGTAGAGCCAGT GGG (reversed) Intergenic