ID: 1029162381

View in Genome Browser
Species Human (GRCh38)
Location 7:98561808-98561830
Sequence TGACTCAGTCAATCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029162381_1029162384 -2 Left 1029162381 7:98561808-98561830 CCAAAGGGAGATTGACTGAGTCA No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data
1029162381_1029162386 19 Left 1029162381 7:98561808-98561830 CCAAAGGGAGATTGACTGAGTCA No data
Right 1029162386 7:98561850-98561872 GGTAAGATAGATTTCAGAGTTGG No data
1029162381_1029162383 -10 Left 1029162381 7:98561808-98561830 CCAAAGGGAGATTGACTGAGTCA No data
Right 1029162383 7:98561821-98561843 GACTGAGTCAGGTACCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029162381 Original CRISPR TGACTCAGTCAATCTCCCTT TGG (reversed) Intergenic