ID: 1029162382

View in Genome Browser
Species Human (GRCh38)
Location 7:98561810-98561832
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029162378_1029162382 -6 Left 1029162378 7:98561793-98561815 CCACTGGCTCTACCACCAAAGGG No data
Right 1029162382 7:98561810-98561832 AAAGGGAGATTGACTGAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 233
1029162375_1029162382 -2 Left 1029162375 7:98561789-98561811 CCTCCCACTGGCTCTACCACCAA No data
Right 1029162382 7:98561810-98561832 AAAGGGAGATTGACTGAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 233
1029162376_1029162382 -5 Left 1029162376 7:98561792-98561814 CCCACTGGCTCTACCACCAAAGG No data
Right 1029162382 7:98561810-98561832 AAAGGGAGATTGACTGAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029162382 Original CRISPR AAAGGGAGATTGACTGAGTC AGG Intergenic