ID: 1029162384

View in Genome Browser
Species Human (GRCh38)
Location 7:98561829-98561851
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029162380_1029162384 1 Left 1029162380 7:98561805-98561827 CCACCAAAGGGAGATTGACTGAG No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data
1029162376_1029162384 14 Left 1029162376 7:98561792-98561814 CCCACTGGCTCTACCACCAAAGG No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data
1029162378_1029162384 13 Left 1029162378 7:98561793-98561815 CCACTGGCTCTACCACCAAAGGG No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data
1029162375_1029162384 17 Left 1029162375 7:98561789-98561811 CCTCCCACTGGCTCTACCACCAA No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data
1029162381_1029162384 -2 Left 1029162381 7:98561808-98561830 CCAAAGGGAGATTGACTGAGTCA No data
Right 1029162384 7:98561829-98561851 CAGGTACCAGCAAGGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029162384 Original CRISPR CAGGTACCAGCAAGGTTCAA AGG Intergenic