ID: 1029162386

View in Genome Browser
Species Human (GRCh38)
Location 7:98561850-98561872
Sequence GGTAAGATAGATTTCAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029162385_1029162386 -8 Left 1029162385 7:98561835-98561857 CCAGCAAGGTTCAAAGGTAAGAT No data
Right 1029162386 7:98561850-98561872 GGTAAGATAGATTTCAGAGTTGG No data
1029162380_1029162386 22 Left 1029162380 7:98561805-98561827 CCACCAAAGGGAGATTGACTGAG No data
Right 1029162386 7:98561850-98561872 GGTAAGATAGATTTCAGAGTTGG No data
1029162381_1029162386 19 Left 1029162381 7:98561808-98561830 CCAAAGGGAGATTGACTGAGTCA No data
Right 1029162386 7:98561850-98561872 GGTAAGATAGATTTCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029162386 Original CRISPR GGTAAGATAGATTTCAGAGT TGG Intergenic