ID: 1029163574

View in Genome Browser
Species Human (GRCh38)
Location 7:98570169-98570191
Sequence CGGAAGAAAGGTTTGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029163562_1029163574 16 Left 1029163562 7:98570130-98570152 CCATTGTTGGGCCCGAGGGAGGC No data
Right 1029163574 7:98570169-98570191 CGGAAGAAAGGTTTGGGGAAGGG No data
1029163566_1029163574 4 Left 1029163566 7:98570142-98570164 CCGAGGGAGGCGAACGGGAAAAC No data
Right 1029163574 7:98570169-98570191 CGGAAGAAAGGTTTGGGGAAGGG No data
1029163558_1029163574 27 Left 1029163558 7:98570119-98570141 CCTTGAATTAGCCATTGTTGGGC No data
Right 1029163574 7:98570169-98570191 CGGAAGAAAGGTTTGGGGAAGGG No data
1029163565_1029163574 5 Left 1029163565 7:98570141-98570163 CCCGAGGGAGGCGAACGGGAAAA No data
Right 1029163574 7:98570169-98570191 CGGAAGAAAGGTTTGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029163574 Original CRISPR CGGAAGAAAGGTTTGGGGAA GGG Intergenic