ID: 1029169103

View in Genome Browser
Species Human (GRCh38)
Location 7:98618126-98618148
Sequence CGCGCGTCGGGACTGCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029169088_1029169103 28 Left 1029169088 7:98618075-98618097 CCCTTCCCACACCGCTGCTCTTG 0: 1
1: 0
2: 1
3: 28
4: 240
Right 1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG No data
1029169094_1029169103 17 Left 1029169094 7:98618086-98618108 CCGCTGCTCTTGCTGGAAGGAAA 0: 1
1: 0
2: 2
3: 26
4: 263
Right 1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG No data
1029169089_1029169103 27 Left 1029169089 7:98618076-98618098 CCTTCCCACACCGCTGCTCTTGC 0: 1
1: 0
2: 3
3: 33
4: 262
Right 1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG No data
1029169092_1029169103 22 Left 1029169092 7:98618081-98618103 CCACACCGCTGCTCTTGCTGGAA 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG No data
1029169091_1029169103 23 Left 1029169091 7:98618080-98618102 CCCACACCGCTGCTCTTGCTGGA 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029169103 Original CRISPR CGCGCGTCGGGACTGCCAGC GGG Intronic
No off target data available for this crispr