ID: 1029169645

View in Genome Browser
Species Human (GRCh38)
Location 7:98621570-98621592
Sequence TCCAATCATAGTACATGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029169645 Original CRISPR TCCAATCATAGTACATGTGG AGG (reversed) Intronic
913097686 1:115534904-115534926 TTCAAGGATAGTAAATGTGGGGG - Intergenic
917754747 1:178088001-178088023 ACCAATCATAGTACATATTATGG - Intergenic
919004642 1:191881003-191881025 CCCAATAATAGTTCATCTGGAGG - Intergenic
921241953 1:213193882-213193904 TCCAATCCCAGCACATTTGGAGG - Intronic
1063365802 10:5489649-5489671 TGCCATCACAGTGCATGTGGAGG + Intergenic
1064101043 10:12464461-12464483 TCAAATTACAGTACACGTGGTGG - Intronic
1068043207 10:51853471-51853493 TATAATCATAGCACACGTGGAGG + Intronic
1071102580 10:82056099-82056121 TCCCATCATAGTACCTGTGTGGG + Intronic
1082826479 11:57583546-57583568 CCAAATAATAGTACATGGGGTGG + Intergenic
1082933164 11:58630137-58630159 TCAAATTATAGTAGAGGTGGGGG - Intergenic
1083971988 11:66083761-66083783 GCCAATTATAATAAATGTGGAGG + Intronic
1091506969 12:1081619-1081641 TTAAATAATAGTACATGTGTTGG + Intronic
1096486741 12:51987669-51987691 TCCAATTTTAGTATATGTGCTGG - Intronic
1097280634 12:57843893-57843915 TGCAATCAAATTACATGGGGAGG + Intronic
1097466471 12:59931196-59931218 TCCAATCAAAATACATAGGGTGG + Intergenic
1097773291 12:63615579-63615601 CACAGTCATAGAACATGTGGAGG - Intronic
1106359917 13:29021465-29021487 TGCAATCATGTTACATGTTGTGG + Intronic
1106800979 13:33255491-33255513 TCCCAGCCTAGTAGATGTGGTGG + Intronic
1106885881 13:34183688-34183710 CCCACTCATAGTACTTCTGGGGG - Intergenic
1107364058 13:39651207-39651229 TCTAATCCTAGTACTTTTGGAGG - Intergenic
1107953760 13:45488929-45488951 TGCAATCCTAGTACATTGGGAGG + Intronic
1111538259 13:89632923-89632945 TCCAATCATATTAGGTGTGCTGG + Intergenic
1111965046 13:94852270-94852292 TCCAATCATAGTGCATGTCCAGG - Intergenic
1113547446 13:111165057-111165079 ACCAATCAGAGAACATGTAGGGG + Intronic
1113706489 13:112436711-112436733 GCCCATCCTAGTACATGTGGGGG - Intergenic
1116834808 14:49759788-49759810 TCCAATCAAAAGACATGTTGTGG - Intergenic
1118897176 14:69954727-69954749 TCCAATCAAACAACATTTGGGGG + Intronic
1120676067 14:87422909-87422931 TCGTATCTTAGAACATGTGGTGG - Intergenic
1120727740 14:87963913-87963935 ACCAATAAATGTACATGTGGTGG - Intronic
1120833783 14:89022164-89022186 TCCAAACATAGGAAATGTGGTGG - Intergenic
1131016077 15:89058715-89058737 GCCAATCATTGGACATGAGGGGG - Intergenic
1133804807 16:9116960-9116982 TGCAATTATAGTATATGTTGAGG - Exonic
1134472814 16:14542260-14542282 TGTAATCATAGTACTTGTAGAGG - Intronic
1138785560 16:59841535-59841557 TTCCATCATAGGACATGTGGTGG - Intergenic
1144081365 17:11767051-11767073 TCCAATTATAGTACAAGGTGCGG + Intronic
1146239656 17:31207889-31207911 TCCAATAATAGGACTTGTTGGGG + Intronic
1153388640 18:4529820-4529842 TCCAATCAAAAGACATGGGGTGG - Intergenic
1153598668 18:6756450-6756472 TCCAAACCTAATAAATGTGGAGG + Intronic
1158190597 18:54824129-54824151 TACAATAAAACTACATGTGGAGG - Intronic
1158230911 18:55254128-55254150 TGGAATCATACAACATGTGGTGG - Intronic
1159085128 18:63781451-63781473 TCCAATGATATTACATCTGATGG - Intronic
1159775132 18:72595978-72596000 TCCAATCAAAAGACATGTAGTGG - Intronic
1160295145 18:77630711-77630733 TACAATGAGAGTACAGGTGGTGG + Intergenic
1164471019 19:28532801-28532823 TGAAATCATAGAATATGTGGCGG - Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
926940558 2:18131758-18131780 TCCAATCACACTACATGGGCTGG + Intronic
929763815 2:44827776-44827798 TCCCATCATAGTATACGGGGAGG - Intergenic
933452626 2:82476311-82476333 GCCCATCATAGTACATTTGCAGG + Intergenic
936236451 2:110746574-110746596 TCCATTCGACGTACATGTGGAGG - Intronic
936487537 2:112939133-112939155 TCCCAGCATGGTACCTGTGGTGG - Intergenic
938309252 2:130276365-130276387 TACAATAATAGGTCATGTGGAGG - Intergenic
943047294 2:182873853-182873875 TCCAATTTTAGTATATGTGCTGG - Intergenic
946508504 2:220327578-220327600 TCCAAAAATAGTAGATGGGGGGG - Intergenic
946581698 2:221135141-221135163 TTGAATCATAATACATTTGGTGG + Intergenic
1176744597 21:10640252-10640274 TCCAGACACAGCACATGTGGAGG + Intergenic
1177867007 21:26524409-26524431 TCCAATCAAAGTTGATGTTGTGG + Intronic
951281987 3:20762455-20762477 TCCAATCAGAATACATAGGGTGG + Intergenic
952166638 3:30756930-30756952 TCCAACCAGAGTCCATGGGGGGG + Intronic
953229274 3:41050274-41050296 TCCAAACACAGTACTAGTGGTGG - Intergenic
954837716 3:53484577-53484599 TGCAATCCTAGTACTTGGGGAGG - Intergenic
964448257 3:156783610-156783632 TCCAATCAAAGTAAATCTAGAGG - Intergenic
967821112 3:193839932-193839954 TCGAATCATATAATATGTGGGGG + Intergenic
974513172 4:62872640-62872662 TCCAATCACAGTGGTTGTGGAGG + Intergenic
975229169 4:71910720-71910742 TCCAATCATGGTAGAAGTGAAGG + Intergenic
975260248 4:72289574-72289596 TCAAACCATAGTACAAGTGCAGG - Intronic
979460052 4:120971702-120971724 TCCATTCATCATACATGTGTTGG - Intergenic
982953516 4:161731527-161731549 TACAATCATAGTAAAGGTGAAGG - Intronic
985331066 4:188834625-188834647 TCCCATCATAGTAGTTGTGAAGG - Intergenic
988263697 5:28925416-28925438 TCTAATTATAATACATGTAGGGG + Intergenic
990399122 5:55419143-55419165 TCCAATCATAAAACATGTGTAGG - Intronic
993141300 5:84037221-84037243 TCCAATCATAGTAGCTGAGTAGG - Intronic
993301996 5:86223313-86223335 TCAAATCATGGTAGATGGGGAGG + Intergenic
994119837 5:96101572-96101594 TACAACAATAGTACAGGTGGTGG - Intergenic
1003676950 6:8213811-8213833 TCCTATCATAGTACTTTTGGTGG + Intergenic
1008819869 6:55618583-55618605 ACAAATCATAGTACCTGTGTTGG - Intergenic
1012904223 6:105045634-105045656 TCCAATTTTAGTATATGTGCTGG + Intronic
1015455197 6:133419000-133419022 TCCACTCATAGGACATAGGGTGG + Intronic
1015911357 6:138170697-138170719 TCCTACCTCAGTACATGTGGAGG - Exonic
1017213730 6:151884745-151884767 TTCTATCCTAGTACATGTGCTGG + Intronic
1018334279 6:162769055-162769077 TCCCACCATGGTAAATGTGGAGG + Intronic
1020864902 7:13547270-13547292 TCCAATCAAATTACATTTAGTGG + Intergenic
1022199868 7:28106035-28106057 TCCAATCCAAGCACATGTGGAGG + Intronic
1022932859 7:35139309-35139331 CACAGTCATAGAACATGTGGAGG - Intergenic
1023751666 7:43378954-43378976 TCCAGACATAGAACATGGGGTGG + Intronic
1024379779 7:48683208-48683230 TCCAAACAAAGTACATTTTGAGG + Intergenic
1027172943 7:75885665-75885687 TCCAATCATAGGGCAAGGGGAGG + Intronic
1029169645 7:98621570-98621592 TCCAATCATAGTACATGTGGAGG - Intronic
1029828777 7:103232073-103232095 CACAGTCATAGAACATGTGGAGG - Intergenic
1031389414 7:121195023-121195045 TCCAATTTTAGTATATGTGTTGG + Intronic
1031889002 7:127272719-127272741 TCCAATGAGAGTACATGTGTAGG + Intergenic
1033500153 7:141939620-141939642 TCCAATCAAAGTACATAGAGTGG + Intronic
1036411334 8:8504744-8504766 TTCAATCAAAGTACATGTAAAGG + Intergenic
1041231795 8:55759806-55759828 TACAATCTTATTACATGTGGGGG + Intronic
1041795795 8:61746608-61746630 TTCAATCATTGTACATGAGGTGG - Intergenic
1045248983 8:100467522-100467544 CCCAATCAAATTACCTGTGGGGG + Intergenic
1047788451 8:128177370-128177392 AAAAATCATAGAACATGTGGGGG + Intergenic
1048646943 8:136431699-136431721 TCCAATCAAAGGACATAAGGTGG + Intergenic
1048958449 8:139556007-139556029 TCCAAACATAGAATATGTGGTGG - Intergenic
1050685046 9:8159078-8159100 TCCAAACCTAGTAAATGTAGAGG + Intergenic
1051032593 9:12699889-12699911 TGCAATCATAGCACAGGAGGGGG + Intronic
1052465900 9:28829298-28829320 TTGAAGGATAGTACATGTGGAGG - Intergenic
1057200058 9:93134938-93134960 TTCAATCATACAACAGGTGGGGG - Intergenic
1058089670 9:100790640-100790662 TCCAAACAAAGTACATCTCGAGG - Intergenic
1058844339 9:108941091-108941113 TCTAATGAAAGTACAAGTGGGGG + Intronic
1060459405 9:123835415-123835437 TACAATCATGGTAGAGGTGGGGG + Intronic
1189508154 X:41634016-41634038 TGTAATCCTAGTACATTTGGAGG - Intronic
1197838602 X:130721408-130721430 TCCACTCATAGTATATCTGCAGG + Intronic
1198681941 X:139192242-139192264 TCCAAAAATATTACATGAGGTGG - Intronic
1201725954 Y:17152425-17152447 TCGAATGATGGTAAATGTGGGGG + Intergenic