ID: 1029170785

View in Genome Browser
Species Human (GRCh38)
Location 7:98627809-98627831
Sequence CAGGGTTAAGACCCTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029170785_1029170796 14 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170796 7:98627846-98627868 GCACTTAGGTAATCCATAGTGGG No data
1029170785_1029170787 -10 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170787 7:98627822-98627844 CTTAACCCTGATACCCAGCAAGG No data
1029170785_1029170792 0 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170792 7:98627832-98627854 ATACCCAGCAAGGGGCACTTAGG 0: 1
1: 0
2: 0
3: 6
4: 109
1029170785_1029170799 29 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170799 7:98627861-98627883 ATAGTGGGTGCTCAGCCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 157
1029170785_1029170800 30 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170800 7:98627862-98627884 TAGTGGGTGCTCAGCCTGTGGGG No data
1029170785_1029170798 28 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170798 7:98627860-98627882 CATAGTGGGTGCTCAGCCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 252
1029170785_1029170789 -8 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170789 7:98627824-98627846 TAACCCTGATACCCAGCAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 128
1029170785_1029170788 -9 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170788 7:98627823-98627845 TTAACCCTGATACCCAGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 192
1029170785_1029170795 13 Left 1029170785 7:98627809-98627831 CCCTGCTCAGGGTCTTAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1029170795 7:98627845-98627867 GGCACTTAGGTAATCCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029170785 Original CRISPR CAGGGTTAAGACCCTGAGCA GGG (reversed) Intronic
900092455 1:926303-926325 CAGGGAGAAGACCCTGACCCAGG - Intronic
902278335 1:15355755-15355777 CAAGGTTAAGACCCTGAAAAAGG + Intronic
903190533 1:21653309-21653331 CAGGGTTCAGAGCCTGGACAGGG + Intronic
903738802 1:25546175-25546197 CTGGGTCACAACCCTGAGCAAGG - Intronic
906448718 1:45925118-45925140 GAGGCTTAAGACCTTAAGCAGGG - Intronic
911421838 1:97652696-97652718 TATGGTGAAGATCCTGAGCATGG + Intronic
912709623 1:111941135-111941157 CAGGGTTAAAAATCAGAGCAGGG + Intronic
912712984 1:111962696-111962718 CATGGTTAGGACCCTGAGGCTGG + Intronic
915404627 1:155650257-155650279 CACTGGTAACACCCTGAGCACGG - Intergenic
917932556 1:179833211-179833233 CTGGGTGAAGACCATGAGCAGGG - Intergenic
920677866 1:208050872-208050894 CTGGCTTAAGACTCTGAGCCTGG - Intronic
922503300 1:226111927-226111949 GAGGCTTAAGTCCTTGAGCATGG + Intergenic
923242320 1:232097780-232097802 GATGGGTAAGACCCTGAGAATGG + Intergenic
923800543 1:237204955-237204977 CAGGGTAATGAGCCTCAGCAGGG + Intronic
924032556 1:239900969-239900991 CAGTGTTGAGACCCTGAACAGGG - Intronic
924142643 1:241041774-241041796 CTGAGTTAAAACCCTGAGCCTGG - Intronic
1062928145 10:1333417-1333439 CAGGGTTCAGATCCTGAGTTGGG + Intronic
1063428564 10:5968126-5968148 AAGTGTTAAGAACCTTAGCACGG + Intronic
1070608950 10:77920315-77920337 AAGGTTTTAGACCTTGAGCAAGG - Intronic
1070697661 10:78574795-78574817 CAGGGTGATGCTCCTGAGCAGGG + Intergenic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1072543420 10:96415423-96415445 AATGATTAAGACCCAGAGCAGGG - Intronic
1075846012 10:125545445-125545467 CAGGGCTAAGACCCTCCCCAGGG - Intergenic
1076106942 10:127831105-127831127 CAGGGCGTAAACCCTGAGCAGGG - Intergenic
1076540488 10:131211342-131211364 CAGGGCTGGGCCCCTGAGCACGG + Intronic
1077413083 11:2412523-2412545 CAGGGTTCAGACTCTGACGAGGG + Intronic
1077694510 11:4382211-4382233 TAGGTTTTGGACCCTGAGCAAGG + Intergenic
1078009977 11:7565498-7565520 AAGGGTGGACACCCTGAGCAAGG - Intronic
1079079527 11:17404610-17404632 CAGGGCTGAGACACAGAGCAGGG + Exonic
1083989327 11:66237192-66237214 CAGGCTTGAGCCCCTGTGCACGG + Intronic
1084360051 11:68663420-68663442 CAGGGCTGAGGCCCTGAGGAGGG - Intergenic
1084858163 11:72001853-72001875 CAGGGTTAAGACTCAGCACAGGG + Exonic
1086305156 11:85472095-85472117 CTGGGTGAAGTCCCTGACCAGGG + Intronic
1087491077 11:98828003-98828025 CAGGATTAGGAGACTGAGCATGG - Intergenic
1092936323 12:13367357-13367379 CAGGGTAATGAGCCTCAGCAGGG - Intergenic
1093441114 12:19197359-19197381 CAGTGTTAAGACCCTGAGGCAGG - Intronic
1095296109 12:40529489-40529511 CAGGGGTTAGTCCCTGAGAAGGG - Intronic
1097933332 12:65215199-65215221 AATGGGAAAGACCCTGAGCAAGG - Intronic
1098464950 12:70776025-70776047 CAGGTGTAAGACCATGAGAAAGG - Intronic
1099277852 12:80600968-80600990 CAGCGTGAAGACCCTGAGGCAGG - Intronic
1099666812 12:85641705-85641727 CAAGTTTCAGTCCCTGAGCAAGG - Intergenic
1099854033 12:88141840-88141862 CAGGCTAAAGAACCTGAGCGTGG + Intronic
1104904206 12:132204852-132204874 CAGGGCTGAGGACCTGAGCACGG - Intronic
1105940399 13:25142441-25142463 TATGGTTAAGACCCAGAGCCTGG + Intergenic
1107149087 13:37091184-37091206 CAGGGTTGGGGCTCTGAGCAGGG + Intergenic
1107732810 13:43365554-43365576 CAGGGTTCAGACCCAGCCCAGGG + Intronic
1108527657 13:51299655-51299677 CAGAGTCATGACCATGAGCATGG + Intergenic
1109356705 13:61239252-61239274 CATGTATAAGACCTTGAGCAAGG - Intergenic
1113363400 13:109652772-109652794 CAGGGTTAAAAGCCTCAGGATGG + Intergenic
1113434806 13:110282672-110282694 CAGGGTACAGACCCTGTGCTTGG - Intronic
1114934483 14:27516074-27516096 CAGTTTTAAGACCCTGGGTAGGG - Intergenic
1117355697 14:54921813-54921835 CAGATTTAAGACCCTGACAAAGG - Intergenic
1119115886 14:72021114-72021136 CAGGGTTCAGACCTAGAGCCTGG - Intronic
1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG + Intergenic
1121016259 14:90551166-90551188 CAGGGTCAAGGCCTTCAGCAAGG - Intronic
1123033841 14:105463790-105463812 CAGGGTTCAGTCCCTGAGCTGGG + Intronic
1125734116 15:41911776-41911798 CAGGGCTAGGCCCCAGAGCAGGG - Intronic
1125915381 15:43482356-43482378 CAGGGATAAGCCCCTGCGCCTGG - Intronic
1128213170 15:65916416-65916438 CAGCATGAAGATCCTGAGCAGGG - Intronic
1128864956 15:71107884-71107906 CAGGGTTAAGCCACTGCTCAAGG + Intronic
1132538746 16:497383-497405 CAGGGTTAAGGCCCTTCCCAGGG + Intronic
1132695503 16:1200058-1200080 GAGGGTCAAGACCCGGATCAGGG - Intronic
1132884340 16:2176006-2176028 CAGGTCAAAGACACTGAGCAAGG - Intronic
1134303172 16:13009401-13009423 CGAGGTTATGATCCTGAGCAAGG - Intronic
1135125711 16:19807669-19807691 CAGGATTAAAACCCAGATCATGG - Intronic
1136316256 16:29456042-29456064 AATGGTGAAGGCCCTGAGCAGGG - Intronic
1136430833 16:30195384-30195406 AATGGTGAAGGCCCTGAGCAGGG - Intronic
1139133682 16:64176805-64176827 CATGGTTAAGATCCTAAGAAAGG - Intergenic
1139405276 16:66712897-66712919 GAGGGTTTGGAACCTGAGCAGGG - Intergenic
1139511279 16:67429964-67429986 CAGGGATGAGGCACTGAGCACGG + Intergenic
1140423225 16:74838408-74838430 CAGGGATCAGAAACTGAGCAAGG + Intergenic
1142006696 16:87692651-87692673 CAGGGTAAAGTCCCTTAGGATGG + Intronic
1143049022 17:4107429-4107451 GAGGTTTTAGAGCCTGAGCAGGG + Intronic
1143663491 17:8342041-8342063 TAGCTTTATGACCCTGAGCAAGG - Intronic
1143899976 17:10166953-10166975 CAGAGTGAAGTCCCAGAGCAGGG - Intronic
1144034082 17:11349882-11349904 CAGGGTTAAGCCCCTGCACTGGG + Intronic
1144948389 17:18981385-18981407 CCGGCTTAAGAGCCTGAGCTTGG + Intronic
1146532466 17:33620977-33620999 CAAGGATAAGACCCTGAGACAGG - Intronic
1147202394 17:38811680-38811702 CAGGGTTAAGACCCTTCCCCTGG - Intronic
1147445615 17:40473656-40473678 CAGGGCTTAGACCCAGGGCAAGG - Intergenic
1147816743 17:43216004-43216026 CAGTGTTATGACCCTGGGCATGG + Intronic
1148959974 17:51384942-51384964 CAGGGTTAAGGGGCTGGGCATGG - Intergenic
1153392916 18:4583422-4583444 CAGAGTTAAGGCCCTGTTCAAGG + Intergenic
1153925432 18:9831563-9831585 CAGGGTAATGAGCCTCAGCAGGG + Intronic
1154470402 18:14694455-14694477 CAGGGGTAAGTCACTGAGCCTGG + Intergenic
1155621578 18:27785938-27785960 GAAGCTTAAGACCCTGAGGAAGG + Intergenic
1157223372 18:45842312-45842334 CAGGGTCTTGACCTTGAGCAGGG - Exonic
1157223374 18:45842319-45842341 CAAGGTCAAGACCCTGCTCAAGG + Exonic
1160625634 18:80202717-80202739 CTGGATGAAGACCCTGAGCAGGG + Exonic
1164399446 19:27892647-27892669 GAGGGGGAATACCCTGAGCAGGG - Intergenic
1164925956 19:32130112-32130134 CAGGCTTAAGCCACTGAGCCTGG + Intergenic
1168279976 19:55300380-55300402 CAGGTATAAGCCCCAGAGCAAGG + Intronic
925128609 2:1478577-1478599 AAGGGTTAACACCCAGCGCATGG - Intronic
925637410 2:5953350-5953372 CAGGGTTCAGATCATGAGAAGGG - Intergenic
926591910 2:14749505-14749527 TAGGGTGAAGACCCAGGGCAGGG - Intergenic
926801161 2:16662161-16662183 CAGTGCTAGGAGCCTGAGCATGG + Intronic
928435781 2:31253691-31253713 GAGGGTCCACACCCTGAGCAAGG - Intronic
931643385 2:64400762-64400784 TAGGGCTCAGACCCTGGGCAAGG - Intergenic
932292426 2:70593798-70593820 CTAGGTTCAGACCCTGGGCAGGG + Intergenic
932310778 2:70738507-70738529 GAGGGTACAGACCCTGAGCTAGG - Intronic
932579928 2:72986463-72986485 CAGGGTCAGGACCATGAGCCTGG + Intronic
933583260 2:84151420-84151442 CAGGGTTAAGAACATCTGCAGGG + Intergenic
941773867 2:169370701-169370723 CAGAGTCAAGACCCTGTGCAGGG + Intergenic
948219608 2:236259333-236259355 CAGGGTTAATACCCTGTGCTAGG + Intronic
1169278346 20:4248283-4248305 CAGGGCTACGACCCAGAGCAGGG + Exonic
1169745220 20:8936151-8936173 CAGGGTCATGAGCCTCAGCAGGG - Intronic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1172945500 20:38685133-38685155 CAGGGATTAAACCCTGGGCAGGG - Intergenic
1173636927 20:44567734-44567756 CAGGATTAAGAACAGGAGCAGGG + Intronic
1175173234 20:57094079-57094101 CAGGGCTGAGTCCCTCAGCAGGG - Intergenic
1175182538 20:57158715-57158737 CAGGGTTAAGGCCCTCCCCAGGG + Intergenic
1178549900 21:33528031-33528053 CATGGTTAAGACCCTCTGAAAGG + Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1180244421 21:46537550-46537572 AAGGGTGAAGGCCCTGACCATGG - Intronic
1181393228 22:22599223-22599245 GAGGGGTGAGACCCTGGGCAGGG - Intergenic
1181631570 22:24154506-24154528 CTTGCTTAAGACCCTGACCATGG + Intronic
1181673446 22:24436855-24436877 CTGGGACAAGACCCTGAGGAAGG + Intronic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1183728184 22:39601149-39601171 CAGGCACAAGACCCAGAGCAGGG - Intronic
1184466886 22:44673750-44673772 CAGGGAGAAGATCCTGAGCGTGG + Intronic
949584826 3:5427244-5427266 CAGGGCTCAGACTCAGAGCAGGG - Intergenic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
952485888 3:33809374-33809396 AAGAGTGAAGGCCCTGAGCAAGG + Intronic
954671625 3:52294189-52294211 GAGGGTTCTGACACTGAGCAAGG - Intergenic
955259998 3:57378749-57378771 CAGAGTTAAGAGGCAGAGCATGG - Intronic
955284861 3:57630471-57630493 CTGGTTTAAGACCCGGAGGAAGG - Exonic
956895412 3:73655015-73655037 CATGGTAAAGACCCTCATCATGG + Intergenic
958056179 3:88415385-88415407 CAGGGTTAAAACAATGAGGATGG + Intergenic
961636571 3:128336585-128336607 CAGGCCTAAGGCCCTGGGCAGGG - Intronic
965498526 3:169428825-169428847 CAGGGTGAAAACCCAGACCAAGG - Intronic
965537219 3:169835822-169835844 CAGTGTTAAGGCCCTGAGCCAGG - Intronic
965940992 3:174181649-174181671 CAGGTTTAAGCCACTGAGCCCGG - Intronic
969322076 4:6418367-6418389 CAAGGTTAAGACACTCATCAAGG + Intronic
969367173 4:6703265-6703287 TGGGGTTCAGAACCTGAGCAGGG - Intergenic
969663003 4:8541187-8541209 CAAGCTGAAGACCCCGAGCAAGG - Intergenic
972833732 4:42843465-42843487 AAGGCTTAGGACCTTGAGCAGGG - Intergenic
974146141 4:57949812-57949834 CAGGGTTAAGATTATGAGTATGG - Intergenic
974180555 4:58379427-58379449 CAGTGATATGACCCTCAGCACGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978083564 4:104622672-104622694 CAGGGAAAAGAGCCCGAGCATGG + Intergenic
978399692 4:108317324-108317346 CAATGTTAAGACCCTGAGAATGG + Intergenic
979305772 4:119141791-119141813 CACCGTTAAGAACCTGTGCAAGG + Intronic
979385726 4:120063662-120063684 CAGGATAAAGACCCTGAAAAAGG + Intronic
981336417 4:143573601-143573623 CAGGTGTAAGACACTGAGCCTGG + Intergenic
984582569 4:181527003-181527025 CAGGGCTAAGTCACTGAGCAAGG - Intergenic
984812543 4:183807627-183807649 CAGGATTAAGAAGCTGAGCTGGG - Intergenic
989483213 5:41956987-41957009 CAGGCTTAAGCCCCTGCGCCTGG + Intergenic
997414465 5:133714415-133714437 CAGGGTTAAGAGCGTGGGCTTGG - Intergenic
999702306 5:154239298-154239320 CAGGGTCATCACCCTGGGCAGGG + Intronic
1000110863 5:158106995-158107017 CAGAGTGAAGACCATGTGCAAGG + Intergenic
1001588408 5:172849128-172849150 CAGAGGTATGACCCTGAGCCAGG - Intronic
1001970594 5:175952203-175952225 AAGGGTTTAAACCCTGGGCAAGG + Intronic
1002246843 5:177891562-177891584 AAGGGTTTAAACCCTGGGCAAGG - Intergenic
1004288049 6:14340874-14340896 CAGGGCTAAGACACTGCTCAGGG + Intergenic
1006067802 6:31474947-31474969 CAGGGCTTTGAGCCTGAGCAGGG + Intergenic
1011819615 6:91235856-91235878 CTAGGAAAAGACCCTGAGCAGGG - Intergenic
1011894031 6:92201528-92201550 CAGTGTTTAGTCCTTGAGCAAGG - Intergenic
1015159979 6:130142264-130142286 CAGGGTTGAGCCACTGAGCTTGG - Intergenic
1017997043 6:159541143-159541165 CTGAGTTCTGACCCTGAGCAGGG - Intergenic
1020472682 7:8556962-8556984 AATGGTTATGACCTTGAGCAAGG - Intronic
1021613124 7:22476746-22476768 CTGGGTCAAGATTCTGAGCATGG + Intronic
1023931547 7:44709290-44709312 CAGGGGAAGGACCCAGAGCAGGG - Intergenic
1024984404 7:55182790-55182812 CCGGGTTATGACCATGAGAATGG - Intronic
1025813054 7:64887823-64887845 CAGGGCTCTGACTCTGAGCAGGG + Intronic
1026193158 7:68148042-68148064 CAGGGGTCAGACCCTCACCAGGG - Intergenic
1029170785 7:98627809-98627831 CAGGGTTAAGACCCTGAGCAGGG - Intronic
1030813106 7:114000830-114000852 CAGGGTTGAGAACCTGAGTCAGG - Intronic
1032421293 7:131782096-131782118 CAAGGCTAAGACCAAGAGCATGG - Intergenic
1039889628 8:41675372-41675394 CAGGGTTGAGTCACTGAGCCCGG + Intronic
1042207255 8:66341910-66341932 GAGGTTTCAGTCCCTGAGCAAGG - Intergenic
1043835279 8:85038230-85038252 CATGGGCAAGAGCCTGAGCAAGG + Intergenic
1044584849 8:93859714-93859736 CAGCTCTAAGCCCCTGAGCATGG - Intronic
1047998850 8:130359948-130359970 CAGGGGTAAGAACCAGAGAACGG - Intronic
1048962611 8:139593305-139593327 CAAGGGCCAGACCCTGAGCAAGG + Intergenic
1049584182 8:143425399-143425421 CGGGGTTAAGGCCCTGGGCCTGG - Intronic
1051370421 9:16354691-16354713 CACCCATAAGACCCTGAGCAAGG + Intergenic
1051478809 9:17537864-17537886 CATGGTTAAGCCCCTCACCAGGG + Intergenic
1053339484 9:37311303-37311325 CTGGGATAACACACTGAGCAGGG - Intronic
1053458490 9:38250327-38250349 CAAGCCTCAGACCCTGAGCAGGG - Intergenic
1054705947 9:68462246-68462268 AAGGGTTCAGCCCCTCAGCATGG + Intronic
1057696647 9:97327761-97327783 CAGAGTTAGGACCCTGGACAGGG + Intronic
1059418082 9:114174389-114174411 AAGAGTTAAAACCTTGAGCAGGG + Intronic
1185615850 X:1421378-1421400 CAGGTGTGAGCCCCTGAGCATGG + Intronic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1188107867 X:26164906-26164928 CATTGTGAGGACCCTGAGCAAGG + Intergenic
1188111263 X:26198158-26198180 CATTGTGAGGACCCTGAGCAAGG + Intergenic
1188113115 X:26215473-26215495 CAAGGTGAGGACCCTGAGTAAGG + Intergenic
1197651993 X:129075229-129075251 CAGAGTTATGGTCCTGAGCAAGG + Intergenic
1200240035 X:154488611-154488633 CAGGGAGGTGACCCTGAGCATGG + Exonic