ID: 1029175901

View in Genome Browser
Species Human (GRCh38)
Location 7:98664285-98664307
Sequence TATTCCTGCCCCATTGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029175901_1029175910 26 Left 1029175901 7:98664285-98664307 CCTATAACAATGGGGCAGGAATA No data
Right 1029175910 7:98664334-98664356 GATCCGCCAGTGCCTTCCAATGG No data
1029175901_1029175904 4 Left 1029175901 7:98664285-98664307 CCTATAACAATGGGGCAGGAATA No data
Right 1029175904 7:98664312-98664334 AACCTCTCTCCTCCAGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029175901 Original CRISPR TATTCCTGCCCCATTGTTAT AGG (reversed) Intergenic
No off target data available for this crispr