ID: 1029177953

View in Genome Browser
Species Human (GRCh38)
Location 7:98678274-98678296
Sequence CTGGCATTGCAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029177945_1029177953 17 Left 1029177945 7:98678234-98678256 CCTGGGCTGTTGAGCTCCCTGCC No data
Right 1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG No data
1029177943_1029177953 24 Left 1029177943 7:98678227-98678249 CCCTGGGCCTGGGCTGTTGAGCT No data
Right 1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG No data
1029177944_1029177953 23 Left 1029177944 7:98678228-98678250 CCTGGGCCTGGGCTGTTGAGCTC No data
Right 1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG No data
1029177949_1029177953 -4 Left 1029177949 7:98678255-98678277 CCTGTGATTTGTGGAACTGCTGG No data
Right 1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG No data
1029177948_1029177953 0 Left 1029177948 7:98678251-98678273 CCTGCCTGTGATTTGTGGAACTG No data
Right 1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG No data
1029177947_1029177953 1 Left 1029177947 7:98678250-98678272 CCCTGCCTGTGATTTGTGGAACT No data
Right 1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029177953 Original CRISPR CTGGCATTGCAGAGGGAAGA AGG Intergenic
No off target data available for this crispr