ID: 1029180002

View in Genome Browser
Species Human (GRCh38)
Location 7:98693533-98693555
Sequence CCTGTACCCACGGTGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029180002_1029180010 30 Left 1029180002 7:98693533-98693555 CCTGGGTGCACCGTGGGTACAGG No data
Right 1029180010 7:98693586-98693608 TGAGACTGACAAGACCAGGCAGG No data
1029180002_1029180006 -4 Left 1029180002 7:98693533-98693555 CCTGGGTGCACCGTGGGTACAGG No data
Right 1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG No data
1029180002_1029180009 26 Left 1029180002 7:98693533-98693555 CCTGGGTGCACCGTGGGTACAGG No data
Right 1029180009 7:98693582-98693604 TCTCTGAGACTGACAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029180002 Original CRISPR CCTGTACCCACGGTGCACCC AGG (reversed) Intergenic
No off target data available for this crispr