ID: 1029180006

View in Genome Browser
Species Human (GRCh38)
Location 7:98693552-98693574
Sequence CAGGGTAACCACACAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029180002_1029180006 -4 Left 1029180002 7:98693533-98693555 CCTGGGTGCACCGTGGGTACAGG No data
Right 1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG No data
1029180001_1029180006 -3 Left 1029180001 7:98693532-98693554 CCCTGGGTGCACCGTGGGTACAG No data
Right 1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029180006 Original CRISPR CAGGGTAACCACACAGCTCC TGG Intergenic
No off target data available for this crispr