ID: 1029184226

View in Genome Browser
Species Human (GRCh38)
Location 7:98727155-98727177
Sequence TGACATGGCAGGAGTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029184226_1029184233 -8 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184233 7:98727170-98727192 CCATGTCATCATTTGAATATGGG No data
1029184226_1029184236 -3 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184236 7:98727175-98727197 TCATCATTTGAATATGGGGTGGG No data
1029184226_1029184238 -1 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184238 7:98727177-98727199 ATCATTTGAATATGGGGTGGGGG No data
1029184226_1029184240 7 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184240 7:98727185-98727207 AATATGGGGTGGGGGGCACTCGG No data
1029184226_1029184235 -4 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184235 7:98727174-98727196 GTCATCATTTGAATATGGGGTGG No data
1029184226_1029184231 -9 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184231 7:98727169-98727191 GCCATGTCATCATTTGAATATGG No data
1029184226_1029184234 -7 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184234 7:98727171-98727193 CATGTCATCATTTGAATATGGGG No data
1029184226_1029184237 -2 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184237 7:98727176-98727198 CATCATTTGAATATGGGGTGGGG No data
1029184226_1029184239 0 Left 1029184226 7:98727155-98727177 CCCAGCCCACTCCTGCCATGTCA No data
Right 1029184239 7:98727178-98727200 TCATTTGAATATGGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029184226 Original CRISPR TGACATGGCAGGAGTGGGCT GGG (reversed) Intergenic
No off target data available for this crispr