ID: 1029188456

View in Genome Browser
Species Human (GRCh38)
Location 7:98755579-98755601
Sequence CTGTAGTTCAGGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029188443_1029188456 23 Left 1029188443 7:98755533-98755555 CCCAGGCACCTTCTCCACCTCCC No data
Right 1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG No data
1029188444_1029188456 22 Left 1029188444 7:98755534-98755556 CCAGGCACCTTCTCCACCTCCCA No data
Right 1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG No data
1029188448_1029188456 3 Left 1029188448 7:98755553-98755575 CCCACAGTCAGCTCAGCTGCCTT No data
Right 1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG No data
1029188445_1029188456 15 Left 1029188445 7:98755541-98755563 CCTTCTCCACCTCCCACAGTCAG No data
Right 1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG No data
1029188447_1029188456 6 Left 1029188447 7:98755550-98755572 CCTCCCACAGTCAGCTCAGCTGC No data
Right 1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG No data
1029188449_1029188456 2 Left 1029188449 7:98755554-98755576 CCACAGTCAGCTCAGCTGCCTTG No data
Right 1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG No data
1029188446_1029188456 9 Left 1029188446 7:98755547-98755569 CCACCTCCCACAGTCAGCTCAGC No data
Right 1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029188456 Original CRISPR CTGTAGTTCAGGAGGAAGGA GGG Intergenic
No off target data available for this crispr