ID: 1029192858

View in Genome Browser
Species Human (GRCh38)
Location 7:98784145-98784167
Sequence AATGTTGAAATGGAGACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029192858_1029192864 25 Left 1029192858 7:98784145-98784167 CCTCCTGTCTCCATTTCAACATT No data
Right 1029192864 7:98784193-98784215 CAGAGCTGCCTAATAATTTTTGG No data
1029192858_1029192865 29 Left 1029192858 7:98784145-98784167 CCTCCTGTCTCCATTTCAACATT No data
Right 1029192865 7:98784197-98784219 GCTGCCTAATAATTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029192858 Original CRISPR AATGTTGAAATGGAGACAGG AGG (reversed) Intergenic
No off target data available for this crispr