ID: 1029192860

View in Genome Browser
Species Human (GRCh38)
Location 7:98784155-98784177
Sequence GAACAAGGTGAATGTTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029192860_1029192864 15 Left 1029192860 7:98784155-98784177 CCATTTCAACATTCACCTTGTTC No data
Right 1029192864 7:98784193-98784215 CAGAGCTGCCTAATAATTTTTGG No data
1029192860_1029192865 19 Left 1029192860 7:98784155-98784177 CCATTTCAACATTCACCTTGTTC No data
Right 1029192865 7:98784197-98784219 GCTGCCTAATAATTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029192860 Original CRISPR GAACAAGGTGAATGTTGAAA TGG (reversed) Intergenic
No off target data available for this crispr