ID: 1029192865

View in Genome Browser
Species Human (GRCh38)
Location 7:98784197-98784219
Sequence GCTGCCTAATAATTTTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029192861_1029192865 4 Left 1029192861 7:98784170-98784192 CCTTGTTCAATGTGAACAATGCC No data
Right 1029192865 7:98784197-98784219 GCTGCCTAATAATTTTTGGATGG No data
1029192858_1029192865 29 Left 1029192858 7:98784145-98784167 CCTCCTGTCTCCATTTCAACATT No data
Right 1029192865 7:98784197-98784219 GCTGCCTAATAATTTTTGGATGG No data
1029192860_1029192865 19 Left 1029192860 7:98784155-98784177 CCATTTCAACATTCACCTTGTTC No data
Right 1029192865 7:98784197-98784219 GCTGCCTAATAATTTTTGGATGG No data
1029192859_1029192865 26 Left 1029192859 7:98784148-98784170 CCTGTCTCCATTTCAACATTCAC No data
Right 1029192865 7:98784197-98784219 GCTGCCTAATAATTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029192865 Original CRISPR GCTGCCTAATAATTTTTGGA TGG Intergenic
No off target data available for this crispr