ID: 1029193904

View in Genome Browser
Species Human (GRCh38)
Location 7:98791079-98791101
Sequence CATTCAGGAGGGTTTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029193904_1029193909 2 Left 1029193904 7:98791079-98791101 CCACCAGCAAACCCTCCTGAATG No data
Right 1029193909 7:98791104-98791126 TGCAGTGAGTTCTTCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029193904 Original CRISPR CATTCAGGAGGGTTTGCTGG TGG (reversed) Intergenic