ID: 1029196616

View in Genome Browser
Species Human (GRCh38)
Location 7:98810047-98810069
Sequence TCACTGCTGTGGACAGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029196616_1029196622 8 Left 1029196616 7:98810047-98810069 CCCACGGCTGTCCACAGCAGTGA No data
Right 1029196622 7:98810078-98810100 GGCTGGTGCCACAGAGAGCCTGG No data
1029196616_1029196625 14 Left 1029196616 7:98810047-98810069 CCCACGGCTGTCCACAGCAGTGA No data
Right 1029196625 7:98810084-98810106 TGCCACAGAGAGCCTGGGCTGGG No data
1029196616_1029196621 -9 Left 1029196616 7:98810047-98810069 CCCACGGCTGTCCACAGCAGTGA No data
Right 1029196621 7:98810061-98810083 CAGCAGTGACTGCTCAGGGCTGG No data
1029196616_1029196624 13 Left 1029196616 7:98810047-98810069 CCCACGGCTGTCCACAGCAGTGA No data
Right 1029196624 7:98810083-98810105 GTGCCACAGAGAGCCTGGGCTGG No data
1029196616_1029196628 16 Left 1029196616 7:98810047-98810069 CCCACGGCTGTCCACAGCAGTGA No data
Right 1029196628 7:98810086-98810108 CCACAGAGAGCCTGGGCTGGGGG No data
1029196616_1029196626 15 Left 1029196616 7:98810047-98810069 CCCACGGCTGTCCACAGCAGTGA No data
Right 1029196626 7:98810085-98810107 GCCACAGAGAGCCTGGGCTGGGG No data
1029196616_1029196623 9 Left 1029196616 7:98810047-98810069 CCCACGGCTGTCCACAGCAGTGA No data
Right 1029196623 7:98810079-98810101 GCTGGTGCCACAGAGAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029196616 Original CRISPR TCACTGCTGTGGACAGCCGT GGG (reversed) Intergenic
No off target data available for this crispr