ID: 1029198447

View in Genome Browser
Species Human (GRCh38)
Location 7:98822855-98822877
Sequence CTGAGCCAGCACTGCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029198443_1029198447 18 Left 1029198443 7:98822814-98822836 CCTAAAGCTGGGGATGAGTCACC No data
Right 1029198447 7:98822855-98822877 CTGAGCCAGCACTGCTCTCCAGG No data
1029198446_1029198447 -3 Left 1029198446 7:98822835-98822857 CCTGTGAATCAGGCAGCAGGCTG No data
Right 1029198447 7:98822855-98822877 CTGAGCCAGCACTGCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029198447 Original CRISPR CTGAGCCAGCACTGCTCTCC AGG Intergenic
No off target data available for this crispr