ID: 1029199782

View in Genome Browser
Species Human (GRCh38)
Location 7:98831183-98831205
Sequence TGGAGCACTTAGAATGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029199782_1029199785 5 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199785 7:98831211-98831233 AGCAGCTATCACTATGGTGTTGG No data
1029199782_1029199786 6 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199786 7:98831212-98831234 GCAGCTATCACTATGGTGTTGGG No data
1029199782_1029199788 26 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199788 7:98831232-98831254 GGGAATTTGCTGGCCTGAAAAGG No data
1029199782_1029199790 30 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199790 7:98831236-98831258 ATTTGCTGGCCTGAAAAGGGAGG No data
1029199782_1029199787 16 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199787 7:98831222-98831244 CTATGGTGTTGGGAATTTGCTGG No data
1029199782_1029199784 -1 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199784 7:98831205-98831227 ATAAATAGCAGCTATCACTATGG No data
1029199782_1029199789 27 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199789 7:98831233-98831255 GGAATTTGCTGGCCTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029199782 Original CRISPR TGGAGCACTTAGAATGTGCT AGG (reversed) Intergenic
No off target data available for this crispr