ID: 1029199785

View in Genome Browser
Species Human (GRCh38)
Location 7:98831211-98831233
Sequence AGCAGCTATCACTATGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029199782_1029199785 5 Left 1029199782 7:98831183-98831205 CCTAGCACATTCTAAGTGCTCCA No data
Right 1029199785 7:98831211-98831233 AGCAGCTATCACTATGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029199785 Original CRISPR AGCAGCTATCACTATGGTGT TGG Intergenic
No off target data available for this crispr