ID: 1029209899

View in Genome Browser
Species Human (GRCh38)
Location 7:98898630-98898652
Sequence CTCAAAATACAGATGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029209899_1029209904 17 Left 1029209899 7:98898630-98898652 CCATTGCCCATCTGTATTTTGAG 0: 1
1: 0
2: 1
3: 38
4: 323
Right 1029209904 7:98898670-98898692 TTCATGAGTCCTTATATATTAGG 0: 1
1: 0
2: 7
3: 36
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029209899 Original CRISPR CTCAAAATACAGATGGGCAA TGG (reversed) Intronic
901307599 1:8244040-8244062 CCCAAAAGAGAAATGGGCAAAGG + Intergenic
902728024 1:18350227-18350249 CTCAAGAGCCAGATGGGCCAGGG + Intronic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903257714 1:22114042-22114064 CTCAAAACAAAGAAGGGAAAGGG - Intergenic
903726121 1:25446593-25446615 TTTAAAATGCAGATGGGCCACGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
906711772 1:47935594-47935616 CTCAAAAAAGCAATGGGCAAAGG + Intronic
906785369 1:48610940-48610962 ATCAAAATACAGAAGGGCAGGGG + Intronic
906897590 1:49793591-49793613 CTCAACATAATGATGGGGAATGG + Intronic
908365966 1:63424139-63424161 CTCAAAAAAAAAATAGGCAAAGG - Intronic
908401735 1:63777618-63777640 CTCAAGATACAGAAGAGAAAGGG - Intronic
909061844 1:70887926-70887948 CTCAAAATAGGTATGGGTAAAGG + Intronic
909113484 1:71507313-71507335 GTCAAACTAAAGATGGGAAATGG + Intronic
911709206 1:101049922-101049944 CTGAAAATAGAGATGAGCCAAGG + Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
913499106 1:119454161-119454183 CTCAGAATACTGATGTGCAGTGG - Intergenic
916371383 1:164099337-164099359 CTCTATTTAAAGATGGGCAAAGG - Intergenic
916759715 1:167805382-167805404 GTCTAAATGCTGATGGGCAAAGG - Intergenic
916800524 1:168211606-168211628 CTGCAAGAACAGATGGGCAATGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
918192386 1:182188240-182188262 CTCAAAAGAGAGAGGGGCAGAGG - Intergenic
918420330 1:184358247-184358269 CTCAATAGAAAGATTGGCAAAGG + Intergenic
918554851 1:185786436-185786458 ATGAAAATACATATAGGCAAAGG + Intronic
919550124 1:198975491-198975513 CTCAAAATACAGGTAGGTAATGG - Intergenic
919722109 1:200849237-200849259 CACAAAAAACTGATGGACAAAGG + Exonic
920145432 1:203857412-203857434 CTCAAAATTAAAATTGGCAATGG - Intergenic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921809126 1:219491793-219491815 CTAAAAGTGCAAATGGGCAAAGG + Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
1063272495 10:4526703-4526725 CTCAAAATAGACAAGGGAAAGGG + Intergenic
1063621477 10:7652868-7652890 CACAATAGAAAGATGGGCAAAGG + Intronic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064277139 10:13916387-13916409 CCCAAAATCCAGAAGGGGAATGG - Intronic
1064630759 10:17308463-17308485 CTCAAATTTCAGATGGGCAGAGG + Intergenic
1065128648 10:22598559-22598581 CTCAAACCAGACATGGGCAAAGG + Intronic
1065632746 10:27697724-27697746 CTCAAAATACAAATTGCAAATGG + Intronic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068958311 10:62841418-62841440 CTCAAAGTAGAGATGTGTAAAGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070102057 10:73397789-73397811 CTTAAAATACAAAAGGGCTAAGG + Intronic
1070385640 10:75921887-75921909 CAGAAAATAGAGGTGGGCAAGGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070828701 10:79405768-79405790 CTCAAAATAGTGATGGGGGAAGG + Intronic
1073262114 10:102198343-102198365 CTCGAACTAAAGATGGGAAATGG - Intergenic
1074461104 10:113637453-113637475 GTTATATTACAGATGGGCAAGGG + Intronic
1074844139 10:117382056-117382078 CTCAAAAAAAAAATAGGCAAAGG - Intergenic
1078042132 11:7876783-7876805 CGCAATATAAAGATTGGCAAAGG - Intergenic
1078522218 11:12072677-12072699 CTCAACTTATGGATGGGCAAAGG + Intergenic
1079418119 11:20259732-20259754 CTTGAAAAACAGATGGGCAGTGG + Intergenic
1079493650 11:21016698-21016720 ATCAATATACAGGTGGGAAAGGG - Intronic
1080191102 11:29550209-29550231 CTCCAATTAAAAATGGGCAAAGG - Intergenic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1081098610 11:38972073-38972095 CTCCAGATACAGATGGGAGATGG + Intergenic
1081230553 11:40580839-40580861 AACAAAATATAGATAGGCAAGGG - Intronic
1083538490 11:63493317-63493339 CTCCAAAGAAAAATGGGCAAAGG - Intergenic
1085074056 11:73573951-73573973 CTCAAAATACCAAGGGGCAGGGG + Intronic
1087177622 11:95109859-95109881 CTCCAAATCCAGGTGGGCATGGG - Intronic
1087190874 11:95252998-95253020 TTAAAAATAAAGATGGGTAAGGG + Intergenic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088509765 11:110562371-110562393 TTTAAAATACAGAGGGGGAATGG - Intergenic
1089236496 11:117031459-117031481 ATCAAAAATCAGTTGGGCAATGG + Intronic
1090960687 11:131553871-131553893 GTGAAAATATATATGGGCAACGG - Intronic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG + Intergenic
1092485006 12:8895467-8895489 CCCAAAAGAAAAATGGGCAAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094332346 12:29308090-29308112 CTCAAAATTCACATGGGTGATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097865187 12:64554214-64554236 GTCAAAATTCAGATGAGCACTGG + Intergenic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1098865470 12:75757894-75757916 CTCAAAAGATAAATGGGAAATGG + Intergenic
1099580447 12:84440067-84440089 CTCAAAATCCAGAAGGGAAAGGG - Intergenic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1105637777 13:22232053-22232075 ATCAAAAAGCAGATGGGAAAAGG - Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106822589 13:33482405-33482427 GACAAAATACTGATGGGCAACGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106888556 13:34217138-34217160 CACAAAATAGACATGGGCCAAGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107379628 13:39841958-39841980 CTCAAAGTACAGATATTCAATGG + Intergenic
1107462032 13:40613523-40613545 CTCAAACTGCAGATGGGGACCGG - Intronic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1108466603 13:50722379-50722401 GTCAAAATACAGATTAGAAAAGG - Intronic
1108893916 13:55298544-55298566 CTCAAAAGTCAGATAGGGAAGGG - Intergenic
1110245596 13:73320168-73320190 ATCAAAATAATGATGGCCAAAGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1113708798 13:112450932-112450954 TTTAGAATACAGATGGCCAAAGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115824091 14:37245743-37245765 TTCAAATTACAGAAAGGCAATGG + Intronic
1116576878 14:46586297-46586319 TTCAAATTACAGATTTGCAAAGG - Intergenic
1116983799 14:51198179-51198201 CTCAAAATACTCATGGTGAAGGG - Intergenic
1117934344 14:60885579-60885601 CTCAACTTAAAAATGGGCAAAGG - Intronic
1118670288 14:68118649-68118671 CTCAAAATACACCTGCACAATGG - Intronic
1118761707 14:68884264-68884286 CTCCAAGTACAGCTGGTCAATGG + Exonic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1125448078 15:39779379-39779401 CAGAAAATACAGATAAGCAAGGG - Intronic
1125782163 15:42279364-42279386 CTCAAAATGCAGGTGGGCCAGGG + Intronic
1126019449 15:44385858-44385880 CCCAACATAAAAATGGGCAAAGG - Intronic
1128669031 15:69560561-69560583 CCCAAAAGCTAGATGGGCAAAGG - Intergenic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1129315716 15:74742505-74742527 CTCAAAGTCCAGAGGGGCAACGG + Intergenic
1130687769 15:86053982-86054004 CACAAAAATCAGATGGGCAAAGG - Intergenic
1131099765 15:89678844-89678866 CTCAAAAAACAGATAGGGAGAGG - Intronic
1131105566 15:89731759-89731781 CTCAATAAACACATGGGCAGTGG - Intronic
1131604370 15:93885547-93885569 CTAAAAATACAGATGGTCCCTGG - Intergenic
1132362783 15:101231470-101231492 CTCAAAATTCAGAAGTGCAAAGG - Intronic
1133566448 16:6999647-6999669 TTCAAAATATTGATGGGGAAGGG - Intronic
1133663337 16:7940383-7940405 CTCCAAAGAGAGATTGGCAATGG + Intergenic
1133664097 16:7948372-7948394 CACAAACTATAGATGGACAAGGG + Intergenic
1134037642 16:11043517-11043539 CTCAAAATGAAAATGGGGAAAGG - Intronic
1134873050 16:17668967-17668989 GCCAAAAAACAGATGGCCAAAGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1139227176 16:65244038-65244060 CTCAAATAACATATGGGAAAGGG + Intergenic
1141902426 16:87000379-87000401 AGCAAAATTCAGATGGGAAAAGG + Intergenic
1143005434 17:3829847-3829869 CCCAAAATAAAAATGGGCAAAGG + Intronic
1145989668 17:29071375-29071397 CCCAAAATAAAGATGGGCTTTGG + Intergenic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146484470 17:33231847-33231869 CTCAAAATTGAGATGAGCAATGG + Intronic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1148463032 17:47848905-47848927 CTCAGGATACAGATGGGAGAGGG + Intronic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150418487 17:65007061-65007083 CTCAAAAAGCAGATGGCCCAGGG - Intergenic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153877567 18:9388158-9388180 CTAGAAATACAGAGGGGCAGAGG - Intronic
1154372932 18:13781135-13781157 CTCAAAAAAAAAGTGGGCAAAGG + Intergenic
1154979470 18:21490659-21490681 CTCAGAAAACAGATGGCCATGGG - Intronic
1156625849 18:38907588-38907610 GACAAAATACGAATGGGCAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159597774 18:70399522-70399544 CTCAAAAGAAAGATTGGCATAGG - Intergenic
1159764930 18:72477886-72477908 CACAAAATGTGGATGGGCAAAGG + Intergenic
1162052958 19:8046230-8046252 CTCAGAAAACAGATGTGGAAAGG + Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1164693474 19:30227271-30227293 CTCACAATACAGAAGTGAAAAGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164812600 19:31169754-31169776 CTCAAAGGACACATGGCCAAGGG - Intergenic
1165340469 19:35208218-35208240 CTGAAAATACAGAAAGGAAATGG + Intergenic
1165967197 19:39592418-39592440 CTCAAAATAAAAGTAGGCAAAGG + Intergenic
1166740053 19:45109125-45109147 CCCAAAATAAAAATAGGCAAAGG - Intronic
1167553659 19:50178836-50178858 TTCTAAATAAAGCTGGGCAAGGG + Intergenic
925648636 2:6064904-6064926 CTTAAAATACACATGGGCTTAGG + Intergenic
925844840 2:8025976-8025998 ATCAGAACACAGCTGGGCAAAGG - Intergenic
926242666 2:11100396-11100418 CTAGAAATACAGGTGGGCATGGG + Intergenic
930392053 2:50773695-50773717 CTCAAAATCCAGTTGGGACAGGG + Intronic
931146101 2:59520598-59520620 CACACAACCCAGATGGGCAAGGG + Intergenic
932815346 2:74856597-74856619 TTCTAAATACATATGGGCTAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933440609 2:82308809-82308831 ATCAAATTAAAAATGGGCAAAGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
935013433 2:99156935-99156957 CACAGAATAGAGATGGGAAAGGG + Intronic
935733522 2:106086332-106086354 ATGAAAATACATATGGGTAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
940764658 2:157776866-157776888 TTTCAAATACACATGGGCAATGG + Intronic
943087767 2:183333764-183333786 CTCAATTAAAAGATGGGCAAAGG - Intergenic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
943726368 2:191255777-191255799 CTCAAAATGCAGAGGGGGTAGGG - Intronic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
944314685 2:198271679-198271701 CTATAAATTCATATGGGCAATGG + Intronic
944709628 2:202324097-202324119 ATGAAAAGACAGAGGGGCAAAGG + Intergenic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947311133 2:228803747-228803769 CTCAAGTTAAAAATGGGCAAAGG - Intergenic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
1169107708 20:3011104-3011126 CTCTAAATAAACATGGTCAAGGG - Intronic
1169609023 20:7358382-7358404 TTCAAAATAAAAATGTGCAATGG + Intergenic
1171465468 20:25324856-25324878 CTCAAAATAAAAAATGGCAAAGG + Intronic
1173010271 20:39175867-39175889 CTTAAACTACAGCTGAGCAAAGG - Intergenic
1173675656 20:44832846-44832868 TTTAAAATTCAGCTGGGCAAAGG + Intergenic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1178224664 21:30701252-30701274 CTCAAAAAACAAATAAGCAAAGG - Intergenic
1178456180 21:32753836-32753858 AACAAATTACAGATGGGAAAAGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178698460 21:34814293-34814315 CTCAAAACACAGAAGGCAAAAGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1182474039 22:30566216-30566238 CTCAAAAGGCAGAAGGTCAATGG - Intronic
1182643468 22:31788102-31788124 TTAAAAAAACAAATGGGCAAAGG + Intronic
1183340561 22:37278387-37278409 CTCATCTTACAGATGGGAAACGG - Intergenic
1184078691 22:42201917-42201939 CTCAAAAGACAGAAGGCAAAAGG - Intronic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
1184843563 22:47066812-47066834 ATTAAAATACAGATGTGGAATGG - Intronic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
949684360 3:6551205-6551227 CTTATAATAGAGATTGGCAATGG + Intergenic
949735312 3:7164880-7164902 CTCAACCCAGAGATGGGCAAGGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
952349538 3:32521147-32521169 CCCAATTTAAAGATGGGCAAGGG - Intergenic
952439960 3:33316697-33316719 CTCAAAATACAGGTGGATGAGGG - Intronic
952592404 3:34972806-34972828 CTTAAAATACAAATGTGGAAAGG + Intergenic
953334564 3:42083276-42083298 CCCAAAAGAAAAATGGGCAAAGG - Intronic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953725055 3:45390287-45390309 ATAAAAATAAAAATGGGCAAAGG - Intronic
954854873 3:53635443-53635465 CCCCAAATCCAGATGGGAAATGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
958512559 3:95066865-95066887 ATCAAAAAAAAAATGGGCAAAGG + Intergenic
958854318 3:99366072-99366094 CTCAAACTACAGATTTGCAGTGG + Intergenic
959441971 3:106387964-106387986 CTCAGAATAAACATGGGCATGGG + Intergenic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
962557087 3:136564707-136564729 GTCAAAAGAAAAATGGGCAAAGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
966213049 3:177472411-177472433 CTCAAAAGATAAAGGGGCAAAGG + Intergenic
968453353 4:685325-685347 CACACAATACACATGGGCACAGG + Intronic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971353522 4:25873523-25873545 CTCAAAGTACAGGTGGCCAATGG + Intronic
971857930 4:32066797-32066819 CTCAAAAGAAAAATGTGCAAAGG + Intergenic
972280007 4:37592721-37592743 CTCACTTTACAGATGGGTAAAGG - Intronic
972408184 4:38766200-38766222 GTCAAAACACAGATGGGCATAGG + Intergenic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
972698879 4:41474492-41474514 ATAAAAATAAAAATGGGCAAAGG + Intronic
973775384 4:54236967-54236989 CTCAAAAAAAAAGTGGGCAATGG - Intronic
975981737 4:80168986-80169008 CTCCAAATACAGATGGGTTAGGG - Intergenic
977482094 4:97592377-97592399 CTCAAAAAACATATTGGCATGGG - Intronic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
979064889 4:116118125-116118147 ATAAAAATAAAAATGGGCAAAGG + Intergenic
979425317 4:120557242-120557264 CTGAAAATTCAGATGTGCAATGG - Intergenic
979833593 4:125332075-125332097 CTCAAAATATAGATCTGCACAGG + Intronic
980162386 4:129181584-129181606 ATAAAAATAAAAATGGGCAAGGG - Intergenic
980937376 4:139238942-139238964 TTCAAATTACAGATTTGCAAAGG - Intergenic
981300265 4:143178888-143178910 CTCAAACTGAAGATGGGAAATGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982230170 4:153201369-153201391 CCCAACCTAAAGATGGGCAAAGG - Intronic
982273680 4:153617914-153617936 TTCAAAAGAAAAATGGGCAAAGG - Intronic
982656691 4:158158886-158158908 CACAAAATAAAAATGGGCAGTGG + Intronic
982681024 4:158430829-158430851 CTCAAATAAAAAATGGGCAAAGG + Intronic
983111640 4:163757458-163757480 CTCAAAATAGGGATGGGCAGAGG - Intronic
983116197 4:163819381-163819403 CACAGAATTCAGATGTGCAATGG - Intronic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
984180633 4:176478608-176478630 CTCAAATTAAAGATAGACAATGG + Intergenic
984203332 4:176754942-176754964 CTGAAAATACAGATTGTCACAGG + Intronic
984263468 4:177469612-177469634 TTCAAAAGAGAGATGGTCAAAGG + Intergenic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987444794 5:18004476-18004498 TTTAAAATACAGCTGGGCATTGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988275074 5:29069943-29069965 GTGAAAATAAAGATGGGCATTGG + Intergenic
988897978 5:35698827-35698849 CTCAAACTACAGCTGAACAAAGG + Intronic
989599263 5:43186641-43186663 TTCAAATTACAGATGTGGAAAGG - Intronic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
991670927 5:69046885-69046907 CTTAAAACACAGATTGCCAACGG + Intergenic
993195680 5:84742264-84742286 CTCAAAAGTCAGAGAGGCAATGG + Intergenic
993265070 5:85716238-85716260 CTCAAAACACAGATGGAAACAGG - Intergenic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
993605451 5:89985344-89985366 GTCAAAATACAAATAGTCAAAGG + Intergenic
995030609 5:107476413-107476435 TTGAAAATACAGATGTGTAAAGG - Intronic
995030671 5:107477433-107477455 CAGAAAATACATATTGGCAAAGG + Intronic
996999022 5:129736296-129736318 CCCAAAATACAGAAGCACAATGG + Intronic
997064452 5:130545257-130545279 CTCAAACTGAAGATGGGAAATGG - Intergenic
997090568 5:130851669-130851691 CTCAATAGAAATATGGGCAAAGG - Intergenic
997610285 5:135210964-135210986 CCCAAATTGCAGATGGGGAAGGG + Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998076710 5:139242523-139242545 ACAAAAATAAAGATGGGCAAAGG + Intronic
998379712 5:141715641-141715663 CTAAAAATACAGAGGAGCAAGGG - Intergenic
999046756 5:148477962-148477984 TAAAAAATAGAGATGGGCAAGGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999199745 5:149807324-149807346 CTCAAAATTCAGATGTGCCTAGG - Intronic
999940478 5:156537234-156537256 CACAAAACACAGATGTGCCAAGG - Intronic
1000149507 5:158485795-158485817 CCCAAAATACAGCCGGGAAACGG + Intergenic
1000322791 5:160148247-160148269 CTAAAAATACAGATTGGGCACGG - Intergenic
1000358870 5:160429373-160429395 ATCAAAATAGAGATGGCAAATGG + Intergenic
1001164392 5:169350423-169350445 TTCAAATTATAGATGGACAAAGG + Intergenic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002805639 6:571649-571671 CACAAAATGGACATGGGCAAAGG - Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008988907 6:57579779-57579801 CTGAAAATAAAGGTGGGCATGGG + Intronic
1009026190 6:58003080-58003102 CTCACAAGGCAGAAGGGCAATGG - Intergenic
1009201739 6:60754553-60754575 CTCACAAGGCAGAAGGGCAAGGG - Intergenic
1010050895 6:71503063-71503085 CTCAAAAGAAATATGGGCTAGGG + Intergenic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011212803 6:84972299-84972321 TTCAAAATAAAAGTGGGCAAGGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1014857342 6:126417929-126417951 CTCAAATAATAAATGGGCAAAGG + Intergenic
1015459875 6:133477437-133477459 CTCAAATAAAAAATGGGCAATGG - Intronic
1015964242 6:138682620-138682642 CTCAAAATACAGTTCAGGAATGG + Intronic
1016326402 6:142907559-142907581 CTCAAATTACAGAGGTGAAAAGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018326649 6:162677278-162677300 ATAAAAAGACAGACGGGCAAGGG + Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1019864382 7:3692374-3692396 TTCTAAATACACATGGGCACAGG - Intronic
1022229096 7:28395835-28395857 CTCAGAAATCAGATTGGCAAGGG + Intronic
1023516272 7:41004963-41004985 CACAAAATACATATCTGCAATGG + Intergenic
1023843782 7:44110113-44110135 CTCAACATGCAGGTGGGCATTGG + Exonic
1024727592 7:52215683-52215705 ATCTAAAAACAGATGGACAATGG + Intergenic
1026811039 7:73465236-73465258 CTCTATATATAGATGGCCAAAGG + Intronic
1027715452 7:81663788-81663810 CCCAAAATACAGATGCTTAAAGG + Intergenic
1028170388 7:87588967-87588989 CCCAATAAAAAGATGGGCAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1031159601 7:118150486-118150508 CTGAAAATACAGCCAGGCAATGG + Intergenic
1033434770 7:141322861-141322883 CTCAAAATACAATGGGGCAGGGG - Intronic
1034014253 7:147565290-147565312 CTCAAAATAAAGCAGGGGAAAGG + Intronic
1036512368 8:9412600-9412622 CTCCAAATACTAATGGGAAATGG + Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1039180816 8:34864136-34864158 CTCAAGAGAGAGTTGGGCAATGG + Intergenic
1039548226 8:38424836-38424858 CTCAAAACAGAGCTGGGGAAAGG + Intronic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041760994 8:61366218-61366240 CCCAAAATATAAATGGGGAAGGG - Intronic
1042474925 8:69236804-69236826 TTCAAAAGAAAAATGGGCAATGG - Intergenic
1042908432 8:73798867-73798889 CTCAGCATATAGATGGGCTAAGG - Intronic
1043505954 8:80902903-80902925 TTCAATTTAAAGATGGGCAAAGG + Intergenic
1043927818 8:86057863-86057885 CTCAAAGTTCACAGGGGCAATGG - Intronic
1046259216 8:111744554-111744576 ATCAAAATATAGAGGGGAAAGGG - Intergenic
1047044061 8:121032098-121032120 GTCAAAGTACAGATGGCTAACGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050916068 9:11134991-11135013 CTCAATATACATATGTGCACAGG + Intergenic
1051498366 9:17750289-17750311 CCGAGAATACAGATGAGCAAAGG - Intronic
1051997129 9:23231257-23231279 TTCAGAATACAGAAGGGCGATGG - Intergenic
1052350438 9:27453335-27453357 CTCAAAATACAAGTATGCAATGG + Intronic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1056496715 9:87162893-87162915 CTGAAAATATTGCTGGGCAAAGG + Intergenic
1057295445 9:93833150-93833172 CCCAATCTATAGATGGGCAAAGG - Intergenic
1057830123 9:98399870-98399892 TTCAAAATAAAAATGGTCAAAGG + Intronic
1058538909 9:105991860-105991882 CTCACAATTCAGATGGGGAGAGG + Intergenic
1059137773 9:111823453-111823475 ATAAAAAAACTGATGGGCAAGGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059533393 9:115058803-115058825 CACATAATAAAGATGAGCAACGG + Intronic
1059571771 9:115445364-115445386 CTCAAAATACAGGTTGGAAATGG + Intergenic
1062256621 9:135626032-135626054 CCCAAAATAAAAAAGGGCAAAGG + Intronic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187992606 X:24891538-24891560 TTCAAAAAACAGTTGTGCAATGG + Intronic
1189299729 X:39943807-39943829 CTCAAAAAACTGATAAGCAAAGG - Intergenic
1189696207 X:43665781-43665803 TACAAAATACAGATAGGCATAGG + Intronic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192478229 X:71462212-71462234 CCCAAAAGAAAAATGGGCAAAGG + Intronic
1194177592 X:90669940-90669962 CTCAAAATATTCATGAGCAATGG - Intergenic
1197579115 X:128259661-128259683 ATAAAAATAAAAATGGGCAAAGG + Intergenic
1199133065 X:144217370-144217392 CACAAAACACAGATAAGCAATGG + Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200524262 Y:4252075-4252097 CTCAAAATATTCATGAGCAATGG - Intergenic