ID: 1029211374

View in Genome Browser
Species Human (GRCh38)
Location 7:98910984-98911006
Sequence TTTTAAGTATGCAGCTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029211374 Original CRISPR TTTTAAGTATGCAGCTGATC TGG Intronic
900264936 1:1752732-1752754 TTTTAAAAAAACAGCTGATCTGG + Exonic
901150892 1:7100574-7100596 TTCTAAGTGCGCAGCTGCTCAGG + Intronic
904059066 1:27693532-27693554 TTTTAATTATGTAGCAGATGTGG + Intergenic
906598899 1:47106284-47106306 TTTTAACAATGCAGCTGTGCTGG + Intronic
909780685 1:79542793-79542815 TATTAAGTATTCAGCTGAAGTGG + Intergenic
909967245 1:81929993-81930015 AATTAAGTAAGCAGCTGACCTGG + Intronic
910568367 1:88671914-88671936 TTTTAAGAATGTAACTGATAAGG + Intergenic
911444461 1:97972851-97972873 TTTTAAGTAGGCAACTAAGCAGG + Intergenic
913600400 1:120416306-120416328 TTTTAAATGTGCAGGTGGTCCGG + Intergenic
913994613 1:143641852-143641874 TTTTAAATGTGCAGGTGGTCTGG - Intergenic
914086653 1:144460337-144460359 TTTTAAATGTGCAGGTGGTCCGG - Intronic
914192550 1:145424270-145424292 TTTTAAATGTGCAGGTGGTCCGG - Intergenic
914361591 1:146940305-146940327 TTTTAAACGTGCAGGTGATCTGG + Intronic
914491015 1:148150398-148150420 TTTTAAACGTGCAGGTGATCTGG - Intronic
914590459 1:149102223-149102245 TTTTAAATGTGCAGGTGGTCCGG - Intronic
918822300 1:189270554-189270576 TTTTAATTTTGCAGCTGTTATGG - Intergenic
919061845 1:192643531-192643553 TTTTAAGGGTGCTGCTTATCTGG - Intronic
920299119 1:204977667-204977689 TCTTACCTTTGCAGCTGATCAGG + Exonic
921420780 1:214945538-214945560 TTTTAAGTATGCAGTTTTTTTGG + Intergenic
922818033 1:228464866-228464888 TTTTGTGTCTGCAGCGGATCTGG + Intergenic
1063253325 10:4298655-4298677 TTTTAAGAAAGCATCTGATATGG + Intergenic
1063367429 10:5499676-5499698 TTTCCTGTCTGCAGCTGATCTGG - Intergenic
1064355160 10:14609999-14610021 TTTTCAGTATTCAGGTCATCAGG - Intronic
1064530417 10:16303200-16303222 CTTCAAGTGTGCAGCTGACCAGG - Intergenic
1064800780 10:19068661-19068683 TTTTAAGTAAGCAAGTGTTCTGG + Intronic
1066578215 10:36849932-36849954 TTTGAAGGATGCAGCTGTTAAGG + Intergenic
1067292371 10:44952978-44953000 TTTTAAGTATGCAGCTTCCAAGG - Intergenic
1069035387 10:63641156-63641178 TTTTAAGTATGAAGTTTAGCTGG - Intergenic
1074692778 10:116021543-116021565 TTTTAAGAATCCTGCTGATATGG - Intergenic
1076009939 10:126979854-126979876 TTATAAGTGTGCAGTTGATTGGG + Intronic
1077574386 11:3370270-3370292 TTTTTAGTATGAGGCTTATCAGG - Intronic
1077743205 11:4870807-4870829 TATCAAGTAGGAAGCTGATCTGG + Intronic
1079751538 11:24205389-24205411 TTTTAAATATGCACATGATGGGG - Intergenic
1079938538 11:26648820-26648842 CTTTGGGTGTGCAGCTGATCCGG + Intronic
1081300668 11:41447042-41447064 TTTTAATTATGCAGAAGATCTGG + Intronic
1082943796 11:58736551-58736573 CTTTAAGTATGCAGCATAACTGG - Intergenic
1084797435 11:71517975-71517997 TTTTTAGTATGAAGCTTACCTGG - Intronic
1085372663 11:76024219-76024241 ATTAAAGTGTGCAACTGATCTGG - Intronic
1085546251 11:77320905-77320927 TATGAAGTGTGCAGCTGATGAGG + Intergenic
1085885469 11:80517115-80517137 TTTTAATTATTCATCTGATATGG + Intergenic
1087741353 11:101890656-101890678 ATTTTAGAATGCAGCTGATCAGG + Exonic
1088551341 11:111015640-111015662 TTTCAAGTATGCAAGAGATCAGG + Intergenic
1089083056 11:115793699-115793721 TTTTAATTAGCCAGCTGAGCAGG + Intergenic
1089944871 11:122459274-122459296 TTTTAAGTATACAGTTGAGTAGG - Intergenic
1093130516 12:15386239-15386261 TTTTAATTATGCATCTGATAAGG - Intronic
1093132961 12:15414726-15414748 TTACAAGTATTCAGATGATCAGG - Intronic
1093821533 12:23625043-23625065 TTTTAAGTGTGCAGGAGAGCAGG + Intronic
1095630874 12:44375572-44375594 TTTTATATATGCAGCTGAGAGGG - Intronic
1099107777 12:78518565-78518587 TTTAAAGTATGCATGTGATCAGG - Intergenic
1099464411 12:82965551-82965573 ATTTAAATATGCAGCTGAGGGGG - Exonic
1099610363 12:84860236-84860258 TTTTAAAAATGTAACTGATCTGG + Exonic
1104994678 12:132646364-132646386 TTTTAAATGTGCAGTTGATTGGG - Intronic
1105289148 13:19036339-19036361 TTTTAAGTAGAGAGCTGGTCAGG + Intergenic
1106072926 13:26430926-26430948 TTTTAAGTTTGTATCTTATCTGG + Intergenic
1106092775 13:26612803-26612825 TTTTAAGTAAGGAGCTAATAAGG - Intronic
1106161737 13:27207316-27207338 TTTCAAGTCTGCAGCTGAGTTGG - Intergenic
1107671569 13:42751418-42751440 TATAAAATATGCAGCTGATGGGG - Intergenic
1109947503 13:69456342-69456364 TTTTTTGTCTGCAGCTGATTTGG + Intergenic
1110943949 13:81389689-81389711 TTTTAAATATCCAGCTCATATGG - Intergenic
1111497511 13:89071397-89071419 TTGGAAGTATGCAGCTAATGGGG - Intergenic
1112008664 13:95275985-95276007 TTCTAAATATGCAGCTATTCAGG - Intronic
1114521061 14:23336400-23336422 TTTTAGGTAAGAAGCTGATTTGG + Intergenic
1117195113 14:53332025-53332047 TTTTAAGTGTCCACCTGATTAGG - Intergenic
1117683316 14:58227597-58227619 TTGTAAGCATGCAGCTCAACTGG + Intronic
1118817408 14:69323239-69323261 TTTTGAGTTTGGAGCTGATGGGG - Intronic
1120155984 14:81093811-81093833 TTTGAAGTTTGGAGCTGAGCAGG - Intronic
1120365215 14:83560434-83560456 TTTTAAAAATATAGCTGATCTGG + Intergenic
1120428708 14:84386418-84386440 CTTTATGTATGCAGCTGAATTGG - Intergenic
1120580553 14:86242638-86242660 TTTTAAGTGAGCAAATGATCTGG + Intergenic
1125152895 15:36553478-36553500 TTTTAAGGCTGCAGCTGAGCTGG - Intergenic
1126350488 15:47740611-47740633 TTTTAAGTATCTTGCTGACCAGG - Intronic
1126425270 15:48520885-48520907 TGTGAAGTATGGAGCTGCTCGGG - Intronic
1126477641 15:49082449-49082471 TATTAAGTAGGCAACTGATGTGG + Intergenic
1126883992 15:53130204-53130226 TTTTTAGCACTCAGCTGATCAGG - Intergenic
1127477817 15:59351209-59351231 TTTTAAGGATTCAGATGAACAGG + Intronic
1129002939 15:72349027-72349049 TTCTGAGTAAGCAACTGATCAGG + Intronic
1131300883 15:91198821-91198843 CTGTATGCATGCAGCTGATCTGG + Intronic
1131913209 15:97231920-97231942 TTTTAAGTATTCATCTGAGATGG - Intergenic
1133775998 16:8895576-8895598 ATTTAAATATGCAGCAGATGGGG + Intronic
1135729271 16:24880901-24880923 TTTTAAGTTTAAAGCTGTTCTGG + Intronic
1136095688 16:27954438-27954460 TTTTCAGTATGGAGCTCAGCTGG - Intronic
1139309466 16:66016283-66016305 TTTTAAGTACCCATGTGATCAGG + Intergenic
1139950888 16:70669030-70669052 TTTTAGATCTGCAGCTCATCTGG - Intronic
1141222049 16:82080182-82080204 TTGTGAGTAGGCAGCTGGTCTGG + Intronic
1144113320 17:12060845-12060867 TTTTAAGTATACAGTTCATTGGG + Intronic
1146624968 17:34428175-34428197 TTTTATCCATGTAGCTGATCAGG + Intergenic
1149781575 17:59400908-59400930 TTTTGAGTATGGAGCTGTTGCGG + Exonic
1151062161 17:71107956-71107978 TTTTAAATCTGAAGCTGATTTGG - Intergenic
1151808104 17:76419375-76419397 TTTTAAGTTTACTGCTGATATGG + Intronic
1156723525 18:40099697-40099719 TTTTATGTATGCATCTGATTTGG + Intergenic
1157966796 18:52217577-52217599 GTTTAATTATGAAGCTGATGAGG - Intergenic
1163887359 19:19978445-19978467 TTTTAAGTATTTAGCCAATCGGG - Intergenic
926597329 2:14805502-14805524 TTTTAAGTAGGAAACTGATATGG + Intergenic
927989046 2:27434623-27434645 TGTTAATAATGAAGCTGATCAGG + Intronic
930020762 2:47000788-47000810 TTTTGAGAATGCGGTTGATCAGG + Intronic
932043824 2:68327093-68327115 TTTTAAATATGCAGGTGTTATGG + Intergenic
933091472 2:78124538-78124560 TTGTAAATCTGTAGCTGATCTGG + Intergenic
933888953 2:86747515-86747537 TTTTAAGCATCCAGTTAATCTGG - Intronic
934058245 2:88270379-88270401 TTTTCATTATGCTCCTGATCAGG + Intergenic
935615358 2:105074432-105074454 TTTAAAGTATGCAGTTGTTATGG + Intronic
937562774 2:123245366-123245388 TCTGAAGAGTGCAGCTGATCCGG + Intergenic
944817679 2:203395071-203395093 TTTTAAGAGTTCAGTTGATCTGG + Intronic
945722741 2:213438801-213438823 TTTTAAAAATGCATCTGATTAGG - Intronic
948688860 2:239689597-239689619 GTTTAAGGATACAGCTGTTCAGG + Intergenic
1170358701 20:15520717-15520739 TCTTCAGTATGCAGCATATCAGG - Intronic
1174981071 20:55395539-55395561 TTTAAAGTTTCCAGGTGATCTGG + Intergenic
1176919864 21:14675138-14675160 TTATAATTATGCTGCTGAGCTGG + Intergenic
1178243658 21:30931292-30931314 TGTTCTGTCTGCAGCTGATCTGG + Intergenic
1179115904 21:38491797-38491819 ATTTAAATCAGCAGCTGATCTGG + Intronic
1180758159 22:18177685-18177707 TTGGAAGTTTGCACCTGATCTGG + Intergenic
1180768448 22:18361477-18361499 TTGGAAGTTTGCACCTGATCTGG + Intergenic
1180777862 22:18500914-18500936 TTGGAAGTTTGCACCTGATCTGG - Intergenic
1180810588 22:18758225-18758247 TTGGAAGTTTGCACCTGATCTGG - Intergenic
1180826325 22:18864701-18864723 TTGGAAGTTTGCACCTGATCTGG + Intergenic
1181196733 22:21192480-21192502 TTGGAAGTTTGCACCTGATCTGG - Intergenic
1181212794 22:21300644-21300666 TTGGAAGTTTGCACCTGATCTGG + Intergenic
1183151463 22:36041088-36041110 GTTTGAGTATGCAGCTGAACTGG + Intergenic
1203230066 22_KI270731v1_random:102365-102387 TTGGAAGTTTGCACCTGATCTGG + Intergenic
1203276466 22_KI270734v1_random:90607-90629 TTGGAAGTTTGCACCTGATCTGG + Intergenic
949397177 3:3627086-3627108 ATTTAAGTGCCCAGCTGATCAGG + Intergenic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
953210648 3:40872169-40872191 TTTTAGGTATCGAGCTGACCTGG + Intergenic
956572014 3:70706784-70706806 TTTAAAGTAAGCCGCTGATGTGG + Intergenic
957246155 3:77719472-77719494 TTATATGTATGCAACTGATATGG + Intergenic
957327143 3:78710939-78710961 TGTTAAGTATACAGATTATCAGG - Intronic
959916138 3:111818740-111818762 TTTTTAGAATTCAGCAGATCTGG - Intronic
960596672 3:119413849-119413871 TTTTCAGGATGAAGATGATCTGG + Exonic
962004014 3:131330102-131330124 TTTTAAAAATGGAGCTGATAGGG + Intronic
966454772 3:180102410-180102432 TTTGAAGAATACAGATGATCTGG + Intergenic
970138046 4:12947862-12947884 TTTTGAGTCTTCAGCTGATTGGG + Intergenic
971175899 4:24282427-24282449 TTTTTGTTATGCAGCTGATTTGG - Intergenic
972380040 4:38510972-38510994 TATGAAGTATGCAGCTCATTTGG + Intergenic
973808856 4:54550820-54550842 TTTTATTTATGCACATGATCAGG - Intergenic
976841975 4:89442367-89442389 ATTTTTGTCTGCAGCTGATCTGG + Intergenic
977017784 4:91715117-91715139 TTTTAAGGACTCAGCTGATTAGG - Intergenic
977530371 4:98193807-98193829 TTTTAAGTTTTTAGCTAATCGGG - Intergenic
982299480 4:153864800-153864822 TTTCAAGAATGCAGCAGTTCTGG + Intergenic
983644387 4:169974916-169974938 TTTTAATTAATCAGCTGATAAGG - Intergenic
985722315 5:1496044-1496066 TTTTAAATATGCAGCTGAACAGG - Intronic
986312925 5:6568090-6568112 TTTTAAGGATTCACCTGATCAGG + Intergenic
987037053 5:14029623-14029645 TTTTAGGCATGCTGCTGATCAGG - Intergenic
987181838 5:15375835-15375857 TTGTAGGTATGAAACTGATCTGG + Intergenic
987753643 5:22072219-22072241 TTTTAAGAATGCTACTCATCTGG + Intronic
987973093 5:24976457-24976479 TTTCAAGTAAGAACCTGATCTGG - Intergenic
988415104 5:30937065-30937087 TTTTAAATCTGCATCTTATCTGG - Intergenic
989441941 5:41482468-41482490 TCTTAAGTATCCTGCTGATAAGG - Intronic
989669170 5:43894080-43894102 GTTTAAGAATGCAGTTTATCTGG + Intergenic
992013116 5:72550508-72550530 TTTCAAGTTTGCAGCTGTTTTGG - Intergenic
993862056 5:93148291-93148313 TTTAATGTATGCAACAGATCAGG - Intergenic
996376333 5:122811962-122811984 TTTGGAGTAGGCAGCTGTTCAGG + Intronic
996755418 5:126930136-126930158 TCTTAAGTATACAGAAGATCTGG + Intronic
997301369 5:132808127-132808149 TCTTAAATATGAAGCAGATCAGG - Intergenic
997427281 5:133812036-133812058 ATTCAAGTATCCAGCTGCTCAGG + Intergenic
999236561 5:150101352-150101374 TCTACAGTATTCAGCTGATCTGG - Intronic
999911061 5:156199854-156199876 TTTTAAATATACAGCTTCTCTGG - Intronic
1002962290 6:1926474-1926496 TTTTAATTATACAGCTGAAATGG - Intronic
1004473936 6:15953618-15953640 TTTTAAGAATCCAGATGCTCAGG + Intergenic
1004981033 6:21024345-21024367 TTTTAAAAATGCAGCTGAAGAGG + Intronic
1005092599 6:22073724-22073746 TTTTTAGTATCAAGCTGAACAGG - Intergenic
1006990804 6:38213167-38213189 TTTTAGGTATGAAATTGATCAGG - Intronic
1007006883 6:38372519-38372541 TTTTAAGTATGAAGCAGGGCAGG + Intronic
1007150646 6:39687552-39687574 TTTGAAGTATGCAGATGAAAGGG + Intronic
1009829777 6:68915244-68915266 TTTTACTTATGAAGCTGATGAGG - Intronic
1011252245 6:85384242-85384264 TTTCAAGAAGGCAGCTGATTAGG + Intergenic
1012373728 6:98536803-98536825 TTTTAAGAAAGCAGATGATTTGG - Intergenic
1013706143 6:112836770-112836792 TGTTGAGCATGCAGCTGATAAGG - Intergenic
1015537673 6:134283075-134283097 TTTAAAGAAGGCAGCTGAGCCGG + Intronic
1021207413 7:17800501-17800523 ATTTAAGTTTGCAGTTCATCTGG - Intronic
1021226165 7:18028973-18028995 TTTTAAGTATACAGCTTCTATGG + Intergenic
1022623506 7:32009566-32009588 CTTTAAGTATGATGTTGATCAGG - Intronic
1024045813 7:45584849-45584871 TGGTAAGCATGCAGCTGATGAGG + Intronic
1026556512 7:71413198-71413220 TTTAAGTTATGCAGCAGATCTGG - Intronic
1029211374 7:98910984-98911006 TTTTAAGTATGCAGCTGATCTGG + Intronic
1029213875 7:98931111-98931133 GTTTAAGAATGCAGCTCCTCCGG - Intronic
1029672741 7:102045160-102045182 TTTCAATTATGCAGCTGGCCTGG - Intronic
1030054520 7:105571330-105571352 TTTTTTGTCTGCAGCTGATCTGG - Intronic
1038248993 8:25885276-25885298 TTTTAAGTGTGCAGCTCATTTGG + Intronic
1039275030 8:35925914-35925936 TTTTAAGTCTGAAAATGATCTGG - Intergenic
1043871679 8:85439765-85439787 TCTTTAGTATGCAGCTCAACGGG - Exonic
1044013943 8:87027937-87027959 ATTTTTGTTTGCAGCTGATCAGG - Intronic
1047033713 8:120912260-120912282 TTTTAAGTATGCCGCTACACTGG - Intergenic
1047602424 8:126439243-126439265 TTTTAAATGTGTTGCTGATCAGG + Intergenic
1049650334 8:143764007-143764029 TTAAAAATATGTAGCTGATCTGG + Intergenic
1056936381 9:90918101-90918123 GTTTAATTTTGCAGCTGTTCTGG - Intergenic
1187826667 X:23338021-23338043 TTTCAAAAATCCAGCTGATCTGG + Intronic
1187830242 X:23373990-23374012 TTTAATGTATGCAGCTTATTTGG + Intronic
1199097275 X:143757936-143757958 TGTTAAGTCTGCAGGTGACCAGG - Intergenic