ID: 1029219036

View in Genome Browser
Species Human (GRCh38)
Location 7:98973529-98973551
Sequence CCATGGCCCCACAGAGGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 312}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029219036_1029219043 -1 Left 1029219036 7:98973529-98973551 CCACGTCCTCTGTGGGGCCATGG 0: 1
1: 0
2: 2
3: 23
4: 312
Right 1029219043 7:98973551-98973573 GCTGCTCTCTGGATGGCGGCTGG No data
1029219036_1029219044 0 Left 1029219036 7:98973529-98973551 CCACGTCCTCTGTGGGGCCATGG 0: 1
1: 0
2: 2
3: 23
4: 312
Right 1029219044 7:98973552-98973574 CTGCTCTCTGGATGGCGGCTGGG 0: 1
1: 0
2: 2
3: 16
4: 183
1029219036_1029219040 -8 Left 1029219036 7:98973529-98973551 CCACGTCCTCTGTGGGGCCATGG 0: 1
1: 0
2: 2
3: 23
4: 312
Right 1029219040 7:98973544-98973566 GGCCATGGCTGCTCTCTGGATGG 0: 1
1: 1
2: 2
3: 36
4: 267
1029219036_1029219046 27 Left 1029219036 7:98973529-98973551 CCACGTCCTCTGTGGGGCCATGG 0: 1
1: 0
2: 2
3: 23
4: 312
Right 1029219046 7:98973579-98973601 ACCAGACGTGGCTGAAATCTCGG 0: 1
1: 0
2: 1
3: 18
4: 109
1029219036_1029219045 15 Left 1029219036 7:98973529-98973551 CCACGTCCTCTGTGGGGCCATGG 0: 1
1: 0
2: 2
3: 23
4: 312
Right 1029219045 7:98973567-98973589 CGGCTGGGCTAGACCAGACGTGG 0: 1
1: 0
2: 0
3: 2
4: 69
1029219036_1029219042 -5 Left 1029219036 7:98973529-98973551 CCACGTCCTCTGTGGGGCCATGG 0: 1
1: 0
2: 2
3: 23
4: 312
Right 1029219042 7:98973547-98973569 CATGGCTGCTCTCTGGATGGCGG 0: 1
1: 0
2: 0
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029219036 Original CRISPR CCATGGCCCCACAGAGGACG TGG (reversed) Intronic
901490524 1:9594298-9594320 CCAAGCCCTCACAGAGGACAAGG - Intronic
901811905 1:11772148-11772170 CCAGGGCCACACAGAGGACAGGG + Exonic
902483787 1:16727947-16727969 CGATGGGCCCACAAAGCACGCGG - Intergenic
902653911 1:17854442-17854464 CCCTGGACACACAGAGGAGGCGG + Intergenic
902830735 1:19010630-19010652 CCATGGCCCCAGGGAGGGAGGGG + Intergenic
903442019 1:23395310-23395332 CCAAGGCCACAGAGGGGACGAGG + Intronic
904233219 1:29094820-29094842 CCAAGGCCCCACAGAGGATGAGG - Intronic
904263072 1:29301888-29301910 CCATGTCCCTACAAAGGACATGG + Intronic
904517105 1:31065229-31065251 TCATGGCCACACAGAAGACTCGG + Intronic
905207641 1:36352022-36352044 CCAAGGCCCCAGAGAGGGCCAGG + Intronic
905471083 1:38192386-38192408 CCTTGTACCCACAGAGGATGAGG - Intergenic
905646977 1:39631931-39631953 TCATGACCTCACAGATGACGGGG - Intronic
906377198 1:45304813-45304835 CCCTGGCCCCACAGAGTGCCAGG + Intronic
911402477 1:97393598-97393620 CCATGTCCCTACAAAGGACATGG + Intronic
912066243 1:105747189-105747211 CCATGTCCCTGCAAAGGACGTGG + Intergenic
912870937 1:113305192-113305214 CCATGTCCCTACAAAGGACATGG + Intergenic
915028152 1:152852608-152852630 CCATGTCCCCACAAAGGACATGG + Intergenic
915058666 1:153160927-153160949 CCATGTCCCTACAAAGGACATGG - Intergenic
915283231 1:154836859-154836881 CCATCACCTCACAGAGGACTTGG + Intronic
915958104 1:160240113-160240135 CCATGACCGCTCAGAGGAAGAGG - Exonic
915964400 1:160293868-160293890 CCCTGCCCCCACTGAGGAAGAGG + Intronic
918824158 1:189300326-189300348 CCATGTCCCTACAAAGGACATGG - Intergenic
921654994 1:217723939-217723961 CCATGTCCCTTCAGAGGACAGGG - Intronic
922336359 1:224621621-224621643 CCATTGCCCCACAGCTGAAGTGG + Intronic
1062767035 10:74004-74026 CCCTGTCCTCACAGCGGACGCGG + Intergenic
1062767474 10:76504-76526 CCCTGTCCTCACAGCGGACGTGG + Intergenic
1063471298 10:6288508-6288530 CCATGTCCCTACAAAGGACATGG + Intergenic
1064828995 10:19440648-19440670 CCATGTCCCTACAAAGGACATGG + Intronic
1064919031 10:20495933-20495955 CCATGTCCCTACAAAGGACATGG + Intergenic
1064926252 10:20572570-20572592 CCATGTCCCTACAAAGGACATGG - Intergenic
1066713570 10:38262641-38262663 CCATGGTCTCCCAGAGGACGAGG - Intergenic
1067088316 10:43254264-43254286 CCATGGCCCCACAGCTGTCCTGG - Intronic
1069641359 10:69957683-69957705 CCATGGCTCCCCAGAGCACAGGG + Intronic
1069896877 10:71685510-71685532 CCCTGGGACCACAGAGGAGGTGG + Intronic
1070628694 10:78069129-78069151 CCATGCCCCCACACAGAAGGTGG - Intergenic
1070781678 10:79141119-79141141 CCATGACGACACAGGGGACGAGG + Intronic
1071243858 10:83741127-83741149 CCAAGGCTGCACAGAGGATGGGG + Intergenic
1071525325 10:86354955-86354977 CCTTGGCCCCACTTAGGGCGGGG - Intronic
1072718890 10:97768833-97768855 CCCTGGCCCCACAGAGATGGGGG - Intronic
1073670097 10:105578735-105578757 CCATGGTCCCACAGAGTCCCAGG - Intergenic
1076910924 10:133388962-133388984 CAATGAACCCACAGAGAACGTGG - Exonic
1077443696 11:2580501-2580523 GCCTGGCTCCCCAGAGGACGGGG + Intronic
1077543103 11:3156914-3156936 CCATGGCCCCACACAGGGTGGGG + Intronic
1080406754 11:31986868-31986890 CCATAGCCCCAAAGATGGCGAGG - Intronic
1081472477 11:43388721-43388743 CCTTGGCCTCACAGAGTACTGGG - Intronic
1082744011 11:56942685-56942707 CCATGTCCCTACAAAGGACATGG + Intergenic
1083497132 11:63065610-63065632 CCATGTCCCTACAAAGGACATGG + Intergenic
1083620023 11:64044625-64044647 CCAAGGTCACACAGAGGAAGGGG + Intronic
1083720916 11:64603135-64603157 ACATGGCCCCCCAGAGGCCCAGG - Intergenic
1083772863 11:64878140-64878162 GCACGGCCCCACTGAGGGCGTGG - Exonic
1084536233 11:69758828-69758850 CCACGGCCCCGGAGAGGAAGCGG + Intergenic
1084639000 11:70413302-70413324 ACATGGCCCAGCAGAGGGCGTGG - Intronic
1084842706 11:71869356-71869378 CCATGTCCCTACAAAGGACATGG + Intronic
1085046982 11:73359412-73359434 TCATCGCCCCACAAAGGAGGGGG - Intronic
1088885468 11:114002969-114002991 CCATTGCCACTCAGAGGAAGGGG - Intergenic
1089303362 11:117512090-117512112 CCTTGGCCCCACAGAGAGCTGGG + Intronic
1089355376 11:117847669-117847691 CCATGTCCCTACAAAGGACATGG + Intronic
1090121461 11:124033199-124033221 CCATGTCCCTACAAAGGACATGG - Intergenic
1090479796 11:127057998-127058020 CCATGAGGCCACAGAGGACAAGG - Intergenic
1091360284 11:134973955-134973977 CTATGAGCCCACCGAGGACGGGG - Intergenic
1091567471 12:1659776-1659798 CCCTGGGCCCTCAGAGGACATGG + Intergenic
1091828167 12:3530878-3530900 CCATAGCCCCACAAAAGAGGCGG + Intronic
1092780534 12:11982208-11982230 CCATGGCCCCACAGAATTGGTGG + Intergenic
1094282006 12:28750514-28750536 CCATTGCTCCCCAGAGGATGCGG + Intergenic
1095983338 12:47984806-47984828 CCATGGCCCCACAGAGCCTCGGG - Intronic
1096618309 12:52847143-52847165 CCAAGACCCCACAGATGACTAGG + Intronic
1096662768 12:53138695-53138717 CCTTGGCCTCCCAGAGGACTGGG + Intergenic
1097035459 12:56120847-56120869 CCATGGCTCCAAGGAGGATGAGG + Exonic
1099342078 12:81449944-81449966 CCATGTCCCTACAAAGGACATGG + Intronic
1099345498 12:81494780-81494802 CCATGTCCCTACAAAGGACATGG - Intronic
1101194674 12:102370078-102370100 CCAAGGCTGCACAGAGGAGGGGG + Intergenic
1101599376 12:106195733-106195755 CCTTGGGCCCACAGAGAATGGGG - Intergenic
1102681123 12:114691392-114691414 CCATGGCCACACAGACCACTGGG + Intergenic
1103723422 12:122986519-122986541 CTATGGCTCCACCAAGGACGTGG - Exonic
1103973787 12:124688868-124688890 CCCTGGCCTCACAGAGGAACTGG - Intergenic
1104041171 12:125132159-125132181 CCAGGGCACCACAGAGGAAGTGG - Intronic
1104890826 12:132139341-132139363 CCGGGGCCCCACAGACGATGAGG - Intronic
1104953305 12:132451942-132451964 CCTGTGGCCCACAGAGGACGGGG + Intergenic
1105253461 13:18722117-18722139 CCATGTCTCCACAGAGGCCACGG + Intergenic
1105371437 13:19805240-19805262 CCTTGGCCCCACAAAGTACTGGG + Intergenic
1109630945 13:65045436-65045458 CCATGTCCCTACAAAGGACATGG - Intergenic
1112881876 13:104117827-104117849 CCATGTCCCTACAAAGGACATGG - Intergenic
1114081051 14:19201565-19201587 CCAGGGCCCCACACAGGTCCAGG + Intergenic
1114338415 14:21716655-21716677 TCATGGCGCCACAGAGAATGGGG + Intergenic
1115249458 14:31330360-31330382 CCAAGGCTGCACAGAGCACGGGG + Intronic
1115288616 14:31745356-31745378 CCATGTCCCTACAAAGGACATGG + Intronic
1115414176 14:33111974-33111996 CCATGTCCCTACAAAGGACATGG + Intronic
1121020189 14:90575327-90575349 CCAAGGCCCCACAGCGAATGGGG + Intronic
1121410169 14:93744176-93744198 CCAAAGCACCACAAAGGACGCGG + Intronic
1122022643 14:98851810-98851832 ACAGGGCCCCAGAGAGGACCAGG + Intergenic
1122176206 14:99921227-99921249 CCATATCCCCACAAAGGACATGG + Intronic
1123422072 15:20142654-20142676 CCAAGGCCACACAAAGGACCAGG + Intergenic
1123531300 15:21149194-21149216 CCAAGGCCACACATAGGACCAGG + Intergenic
1123699303 15:22902785-22902807 CCACGGCCCCACAGGAAACGCGG + Intronic
1124203314 15:27696977-27696999 GCATGGGCACACAGAGGACGTGG - Intergenic
1124490726 15:30153380-30153402 CCATGGACCCACAGCTGAAGCGG - Intergenic
1124608087 15:31186100-31186122 CCCTGGCCTCTCAGAGGACTGGG - Intergenic
1124752807 15:32384949-32384971 CCATGGACCCACAGCTGAAGCGG + Intergenic
1126100916 15:45117726-45117748 CCACGGCCCCTCCGAGGAAGAGG - Exonic
1129254340 15:74325575-74325597 CCATGGCCCCAGTGTGGACATGG + Intronic
1129799839 15:78405686-78405708 CCCGGGGCCCAGAGAGGACGTGG + Intergenic
1129870169 15:78934817-78934839 CCCTGGCCCCTCAAAGGAAGAGG + Intronic
1131249084 15:90819213-90819235 CCACGGCCCCACAGAGGGTTCGG + Intergenic
1131249099 15:90819260-90819282 CCACGGCCCCACAGAGGGTTCGG + Intergenic
1131249114 15:90819307-90819329 CCACGGCCCCACAGAGGGTTCGG + Intergenic
1131249129 15:90819354-90819376 CCACGGCCCCACAGAGGGTTCGG + Intergenic
1131249144 15:90819401-90819423 CCACGGCCCCACAGAGGGTTCGG + Intergenic
1131439495 15:92448278-92448300 CAATGGCCCCACGGAGGGAGAGG - Intronic
1131655618 15:94455070-94455092 CCATGGCCTCCCAGAGTACTGGG + Intronic
1132698704 16:1213165-1213187 CCATGGCCCCTTGGAGGATGGGG + Intronic
1132770928 16:1562865-1562887 CAATGGACCCACAGAGCATGTGG - Intronic
1132841293 16:1979569-1979591 CCGCGGGGCCACAGAGGACGAGG + Exonic
1133229606 16:4360335-4360357 CCAGGGCCCAAGGGAGGACGCGG - Exonic
1135187994 16:20331620-20331642 CCATGGCCTGACAGTGGACAGGG + Intergenic
1136697897 16:32102318-32102340 CCATGTCCCTACAAAGGACATGG + Intergenic
1136798395 16:33045601-33045623 CCATGTCCCTACAAAGGACATGG + Intergenic
1137382708 16:48013673-48013695 CCATGGCCCCAGGGAGGTGGGGG + Intergenic
1138430411 16:56964797-56964819 CCAAGGTCACACAGAGGGCGTGG - Intronic
1140420774 16:74817149-74817171 CCATGGCCCCACTGAGCCCCAGG + Intergenic
1140477218 16:75245083-75245105 CCAGAGCCCCACAGAGGAGCGGG + Intronic
1142033540 16:87850279-87850301 GCAGGGCCCCACACAGGAGGAGG + Intronic
1142149069 16:88504832-88504854 CCCTGGCCCCACAGGGGCAGTGG - Intronic
1142298901 16:89244837-89244859 CTATGACACCACCGAGGACGTGG - Intergenic
1142338982 16:89508472-89508494 CCTGGGCCCCACAGCGGCCGAGG - Exonic
1143116530 17:4584587-4584609 CCATGGCCCAGCAGAGCGCGCGG - Exonic
1143626156 17:8111220-8111242 CCATGGCTGCCCAGAGGATGAGG + Intronic
1143901382 17:10177175-10177197 CAAAGGCCACACAGAGGAAGGGG + Intronic
1149867105 17:60157133-60157155 CCAGGGCACCACAGAGGAGGTGG + Intronic
1151436162 17:74099171-74099193 CCCTGGCTCCACAGGGGACACGG + Intergenic
1151472532 17:74326942-74326964 CCATGGCCCCACAGAGCCCTGGG + Intronic
1151717110 17:75836534-75836556 CCCTGACCCCACCGAGGAAGAGG + Intronic
1152209050 17:78993366-78993388 CCCGGGCCCCACGGAGGCCGCGG - Exonic
1152959891 18:73357-73379 CCCTGTCCTCACAGCGGACGCGG + Intronic
1152960309 18:75850-75872 CCCTGTCCTCACAGCGGACGTGG + Intergenic
1154499372 18:14987556-14987578 CCAGGGCCCCACACAGGTCCAGG - Intergenic
1158445075 18:57512438-57512460 CCAGGGACCCACAAAGGACAAGG + Intergenic
1158517586 18:58143660-58143682 CCATGTCCCCAGAGAGGCCGTGG + Intronic
1158624128 18:59057052-59057074 GCATGGCCCCAAGGAGGATGAGG - Intergenic
1160663260 19:311332-311354 GCAGAGACCCACAGAGGACGTGG + Intronic
1160952730 19:1675452-1675474 CCAGCGCCCCACCGAGGAGGGGG - Intergenic
1161377372 19:3946879-3946901 CCTTGGCCCCACAGAGTGCTGGG - Intergenic
1161670190 19:5603017-5603039 CCTTGGCCCCACAAAAGACTGGG - Intronic
1162087098 19:8255531-8255553 CCATGTCCCCAGACAGGACTTGG - Intronic
1162177349 19:8840935-8840957 CCATGGCGTCACAGAGAACAGGG + Exonic
1164006489 19:21154324-21154346 CCATGTCCCTACAAAGGACATGG + Intronic
1164181380 19:22821856-22821878 CCTTGGCCCCCCAGAGGACTGGG - Intergenic
1165159218 19:33805959-33805981 CCATTGCCCTTCAGAGGACAGGG + Intronic
1166130763 19:40744349-40744371 CCATGGCCCCAGCGAAGAGGTGG + Intronic
1166136566 19:40780733-40780755 CCATGGCCTCCCAAAGCACGGGG - Intronic
1166400007 19:42471631-42471653 CCATGGGCACACGGAGGATGTGG + Intergenic
1166764634 19:45245469-45245491 CCCTGGCCCCAGAGAGGGAGGGG - Intronic
1167995107 19:53395582-53395604 CCAGGACCAGACAGAGGACGCGG - Intronic
1168134101 19:54338815-54338837 CCTTGTCCCCAGAGAGGAGGAGG + Intronic
925164794 2:1709398-1709420 GCACGGCCCCACAGAAGACAGGG + Intronic
927648283 2:24894230-24894252 CCATGGCCTCGCAGAGGGCTGGG - Intronic
927855157 2:26523180-26523202 CCATGGACCCTCAGAGGTCCCGG + Intronic
929531473 2:42755717-42755739 CCATGGCCCCAGAAAGGGAGCGG - Exonic
930026893 2:47034483-47034505 CCATCGCCCCACAGAGCCCATGG - Intronic
930708440 2:54527136-54527158 CCATGGCCCCAGTGAGGGTGAGG + Intronic
931332942 2:61307151-61307173 CCATGTCCCTACAAAGGACATGG - Intronic
931994795 2:67829604-67829626 CCAAGGTCACACAGAGGAGGAGG + Intergenic
933116543 2:78480040-78480062 CCATGTCCCTACAAAGGACATGG - Intergenic
933954578 2:87354855-87354877 CCAAGGCCACACATAGGACCAGG - Intergenic
934238773 2:90251075-90251097 CCAAGGCCACACATAGGACCAGG - Intergenic
934274423 2:91565635-91565657 CCAAGGCCACACATAGGACCAGG + Intergenic
934676621 2:96253912-96253934 CCACTACCCCACAGAGGAAGAGG - Exonic
934892983 2:98087050-98087072 CCATCGCCCCAGTGAGGGCGCGG + Intergenic
935738017 2:106121880-106121902 CCGTGGTACCACAGAGGACAGGG - Intronic
937345701 2:121124078-121124100 CCATGGACTCCCTGAGGACGGGG + Intergenic
937733294 2:125260230-125260252 CCATGTCCCTACAAAGGACATGG - Intergenic
937922997 2:127145620-127145642 TCTTGGCCCCACAGAGGTCTTGG - Intergenic
939039734 2:137173642-137173664 CCATTGCCCCACAAACGATGAGG - Intronic
941203411 2:162542555-162542577 CCATGTCCCTACAAAGGACATGG + Intronic
945190484 2:207182482-207182504 CCCAGGCCCCACAGAGGAGAGGG + Intergenic
945515527 2:210759270-210759292 CCATGTCCCTACAAAGGACATGG + Intergenic
945826149 2:214722460-214722482 CCATGTCCCTACAAAGGACATGG - Intergenic
945948156 2:216013725-216013747 CCCTGGAGCCACAGAGCACGAGG + Intronic
947423955 2:229965680-229965702 CCATGTCCCTACAAAGGACATGG + Intronic
947456215 2:230256359-230256381 CCATGTCCCTACAAAGGACATGG - Intronic
947472787 2:230413845-230413867 CCATTGCCCCACAGAAAAGGTGG + Intergenic
948640960 2:239375771-239375793 CCATGGCCCCCCAGGGGGCCTGG + Intronic
1170594206 20:17793163-17793185 CCAGGGCACCACAGAGGAGCCGG - Intergenic
1172098718 20:32473335-32473357 CCAGAGCCCCCCAGAGCACGTGG + Intronic
1172781223 20:37437928-37437950 CCCAGGCCCCACAGAGCCCGTGG - Intergenic
1173735224 20:45356480-45356502 CCATGGCCTCCCAGAGGGCTGGG - Intergenic
1174187433 20:48716619-48716641 CCATGGCCCGAGAGAGGAGCAGG - Intronic
1174742102 20:53024801-53024823 CCATGTCCCTGCAAAGGACGTGG + Intronic
1175739672 20:61411893-61411915 GCATGGCCCAACAGGGGACTGGG + Intronic
1175958928 20:62625325-62625347 CCTTGGCCACACGGAGGACACGG - Intergenic
1176039965 20:63060153-63060175 CCAGGACCCCTCCGAGGACGAGG - Intergenic
1176073420 20:63238097-63238119 CCCTGGCCCCACAGGGCACTGGG + Intronic
1176771892 21:13082219-13082241 CCATGTCCCTACAAAGGACATGG + Intergenic
1176838967 21:13822053-13822075 CCATGTCTCCACAGAGGCCACGG + Intergenic
1179880219 21:44290497-44290519 CCAGGGCCCCACAGAGCCCCTGG - Intronic
1180011057 21:45051789-45051811 CCATGGCCACGCAGCGGTCGGGG - Intergenic
1180499722 22:15921120-15921142 CCAGGGCCCCACACAGGTCCAGG - Intergenic
1181355032 22:22292303-22292325 CCAAGGCCACACATAGGACCAGG + Intergenic
1182257826 22:29050771-29050793 CCACGGCCCCACAGGGGCCTGGG + Exonic
1182835259 22:33336701-33336723 CCATGGCCCCACAGGAAACAAGG - Intronic
1183720978 22:39561156-39561178 CCATGTCCCCACAAAGCACCTGG - Intergenic
1184200317 22:42964165-42964187 CCTTGGCCCCACAAAGTACTGGG - Intronic
1184477397 22:44729072-44729094 CCAGGGCCCAGCAGAGGACCAGG - Intronic
1184658466 22:45954163-45954185 CCATGGAACCACACAGTACGTGG - Intronic
1184754248 22:46507479-46507501 CCAGGGCCACACAGAGGCCGGGG - Intronic
1185129979 22:49033331-49033353 CCACGGCCCCCCAGAGGGTGCGG - Intergenic
1185310545 22:50151873-50151895 CCCAGGCCCCACACAGGACAAGG - Intronic
1185315097 22:50175574-50175596 CGATGTCCCCACCGAGGACTCGG + Intronic
950217347 3:11168929-11168951 CCATAGCCCCACAGAGCAGTGGG + Intronic
951176480 3:19606964-19606986 CCATGTCCCTACAAAGGACATGG - Intergenic
953114301 3:39976732-39976754 CCATGTCCCTACAAAGGACAAGG - Intronic
953482453 3:43263019-43263041 CCAGGACCCTACAGAGGACCTGG - Intergenic
953869560 3:46614696-46614718 GCATGGCCCTACATAGGACATGG + Intronic
953963848 3:47286877-47286899 CCAGGGCACCACAGAAGACAAGG - Intronic
954534247 3:51346444-51346466 CCATGTCCCTACAAAGGACATGG + Intronic
955131783 3:56176848-56176870 CCATGGCCCCACCTAGGTAGTGG - Intronic
955227580 3:57073785-57073807 CCATGGCCACCCAGAGGCCTTGG + Exonic
956390236 3:68764229-68764251 CCATACCCCCACAGAGAAAGAGG + Intronic
957869069 3:86064359-86064381 CCATGTCCCTACAAAGGACATGG + Intronic
958925935 3:100157004-100157026 CCTTGGCCCCACAAAGCACTAGG + Intronic
960489577 3:118297933-118297955 CCATGTCCCTACAAAGGACATGG + Intergenic
961461252 3:127051803-127051825 TCATGGCCCCACAGAGGGGTGGG - Intergenic
963069949 3:141295845-141295867 CCATGTCCCTACAAAGGACATGG + Intergenic
964222183 3:154359544-154359566 CTATGGGCCCACAGAGGTCGTGG + Intronic
964247529 3:154670507-154670529 CCATGTGCCCACAGAGAAAGAGG - Intergenic
965304472 3:167046496-167046518 CCATGTCCCTACAAAGGACATGG - Intergenic
967235905 3:187383362-187383384 CCATGGCCCCCCAGAAAAGGTGG - Intergenic
967527267 3:190509177-190509199 CCAGGGCACCACAGAGGAAGTGG + Intergenic
968311770 3:197689514-197689536 ACATGCCCCCACAGAGGACTGGG + Intronic
968461219 4:726009-726031 CCATGGACACACGGTGGACGGGG - Intronic
968469547 4:773067-773089 CCAGGGCCCCTCAGAGGTTGAGG + Intergenic
968625281 4:1624132-1624154 CCCTGGCCCCACTGAGCAAGGGG - Intronic
968657190 4:1783703-1783725 CCCTGGCCCCACAGAGGCCTGGG - Intergenic
969665467 4:8554783-8554805 CCGGGGCACCACGGAGGACGTGG - Intergenic
969674950 4:8609561-8609583 CCATGGCCCCCAAGAGCACAGGG - Intronic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
970856985 4:20660332-20660354 CCATGTCCCTACAAAGGACATGG + Intergenic
971434462 4:26605358-26605380 CCATGTCCCTACAAAGGACATGG + Intronic
971972192 4:33634903-33634925 CCAGGGCTGCACAGAGGAGGGGG - Intergenic
972180297 4:36456641-36456663 CCATGTCCCTACAAAGGACATGG - Intergenic
972479038 4:39480454-39480476 CGCTGGCCGCACAGGGGACGTGG - Intergenic
975888904 4:79000646-79000668 CCATGTCCCTACAAAGGACATGG + Intergenic
976678091 4:87725505-87725527 CCAAGGCTGCACAGAGGAGGGGG - Intergenic
977404283 4:96576196-96576218 CCATGTCCCTACAAAGGACATGG + Intergenic
979320972 4:119324571-119324593 CCATGTCCCTACAAAGGACATGG + Intergenic
981887074 4:149689245-149689267 CCATGTCCCTACAAAGGACATGG - Intergenic
983614394 4:169686009-169686031 CCATGTCCCAACAAAGGACATGG - Intronic
984438668 4:179737044-179737066 CCATGTCGCTACAAAGGACGTGG - Intergenic
985864436 5:2503246-2503268 CCATGGCCCCACAGAGGCAGGGG - Intergenic
986784852 5:11104931-11104953 CCGTGGCCCCCCACAGGAGGAGG - Intronic
987306901 5:16645554-16645576 CCATGTCCCTACAAAGGACATGG + Intergenic
987370236 5:17186445-17186467 CCCTGGCAGCTCAGAGGACGGGG + Intronic
988395789 5:30696749-30696771 CCATGTCCCTACAAAGGACATGG - Intergenic
989738013 5:44731753-44731775 CCATGTCCCCGCAAAGGACATGG + Intergenic
989818159 5:45761862-45761884 CCATGTCCCTGCAAAGGACGTGG + Intergenic
991147332 5:63322158-63322180 CCATGTCCCTACAAAGGACATGG - Intergenic
993117750 5:83737422-83737444 CCATGTCCCTACAAAGGACATGG + Intergenic
993283604 5:85960301-85960323 CCATGTTCCCACAAAGGACATGG + Intergenic
993967210 5:94372603-94372625 CCAGGGCTGCACAGAGGAGGGGG + Intronic
994205897 5:97035029-97035051 CCATGTCCCAGCAGAGGACTGGG - Exonic
994241297 5:97424506-97424528 CCATGTCCCTGCAGAGGACGTGG + Intergenic
994645048 5:102457937-102457959 CCATGTCCCTACAAAGGACATGG - Intronic
994809191 5:104491225-104491247 CCATGTCCCTACAAAGGACATGG - Intergenic
996276663 5:121675005-121675027 CCATGTCCCTACAAAGGACATGG - Intergenic
997267200 5:132501761-132501783 ACCTGGCCCCACAGAGGATTTGG + Intergenic
997586592 5:135047265-135047287 CCTTGGGGCCACAGAGGATGGGG + Intronic
997873762 5:137529501-137529523 CCATGTCCCTACAAAGGACATGG - Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1006391875 6:33763359-33763381 TCATTGCCCCTCAGAGGACAAGG + Intergenic
1006579283 6:35067302-35067324 GCATGGGCCCAGAGAGGAGGGGG - Intronic
1007407661 6:41644275-41644297 CCATGGCTCCACGGAGGCAGGGG - Intronic
1007964948 6:45995801-45995823 CCATGTCCCCGCAAAGGACATGG - Intronic
1008449389 6:51632617-51632639 CCATGAGGCCACAGAGGACAGGG + Exonic
1008634846 6:53400355-53400377 CCATGTCCCTACAAAGGACATGG + Intergenic
1009331350 6:62424826-62424848 CCATGTCCCTGCAGAGGACGTGG - Intergenic
1010318266 6:74475604-74475626 CCATGTCCCTGCAGAGGACATGG - Intergenic
1010836116 6:80589018-80589040 CCATGGCCACTGAGAGGACTTGG - Intergenic
1011499627 6:87973494-87973516 CCATGTCCCTACAAAGGACATGG + Intergenic
1012020260 6:93909136-93909158 CCATGTCCCCACAAAGGACATGG - Intergenic
1012993303 6:105947889-105947911 CCATGTCCCTACAAAGGACATGG - Intergenic
1013948101 6:115746818-115746840 CCATGTCCCTACAAAGGACATGG - Intergenic
1014201456 6:118613504-118613526 CCTTGGCCCCACAAAGTACTAGG - Intronic
1015658483 6:135546653-135546675 CCTTGGCCCCACAGAACCCGAGG - Intergenic
1017061694 6:150490837-150490859 CCGTGGCCCCACACAGGCCTGGG - Intergenic
1017978251 6:159376254-159376276 CCATCGCCCCACAGTGCACAAGG + Intergenic
1018198846 6:161377388-161377410 CCATGGCCCCACGGTGGTAGTGG + Intronic
1018903344 6:168062062-168062084 CCATGGCCCCCAGGGGGACGAGG + Intronic
1021576271 7:22108795-22108817 CCATGGCCTGCCAGAGGAGGGGG - Intergenic
1029219036 7:98973529-98973551 CCATGGCCCCACAGAGGACGTGG - Intronic
1029879816 7:103796616-103796638 CCATGGCCTCTCAGAGTACTGGG - Intronic
1031715680 7:125106408-125106430 CCATGTCCCTACAAAGGACATGG - Intergenic
1032474250 7:132201651-132201673 CCATGGTGCCACAGATGACATGG + Intronic
1032512320 7:132481727-132481749 CCATGGCCACACAGAGTTCTCGG + Intronic
1034089215 7:148348538-148348560 CCAGGCCCTCACGGAGGACGAGG + Intronic
1034954472 7:155326067-155326089 CCATGGCTCCCCAGAGTACTTGG - Intergenic
1036050679 8:5192836-5192858 CCATGTCCCTACAAAGGACATGG - Intergenic
1036445935 8:8822079-8822101 CCCTGGCCACACACAAGACGAGG + Intronic
1038020935 8:23551360-23551382 CCAAGGCCCCAAAGAGCAAGGGG - Intronic
1038492728 8:27982133-27982155 CCATGGCCGCAAATAGGACCTGG - Intronic
1039573556 8:38605679-38605701 ACATGGCCCCAGAGAGCTCGGGG - Intergenic
1041301948 8:56420924-56420946 CCATGTCCCTACAAAGGACATGG - Intergenic
1041445602 8:57948343-57948365 CCATGGCCCCAAAGAGGCAGGGG + Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1045664702 8:104471692-104471714 CCATGGCCCCCCAGAGTCAGGGG - Intergenic
1047137655 8:122098842-122098864 CCATGTCCCTACAAAGGACATGG + Intergenic
1049032457 8:140047852-140047874 CCATGACCCAGCAGAGGTCGGGG + Intronic
1049414383 8:142488647-142488669 CCCTGGCCCCAGAGAGGGCAAGG - Intronic
1049597283 8:143490478-143490500 CCAGGGCCCCACTGGGGAGGAGG - Intronic
1055675365 9:78653762-78653784 CCATGTCCCTACAAAGGACATGG - Intergenic
1056911596 9:90706147-90706169 CCATGGCCCCAGAGGGGTCTGGG - Intergenic
1057123950 9:92601663-92601685 CCATGTGCCCACAGAGGAGTGGG + Intronic
1057258336 9:93568623-93568645 CCATGGCCACCCCGAGGACAGGG + Intergenic
1057301928 9:93891512-93891534 CAAGGGCCCCAGAGAGGAGGTGG + Intergenic
1057911344 9:99022560-99022582 CCATCGCCCAAGAGAGGAGGAGG - Intronic
1059078740 9:111224192-111224214 CCATGTCCCTACAAAGGACATGG - Intergenic
1060656952 9:125378518-125378540 CCATGGCCTCACAGGGGACAAGG - Intergenic
1060823373 9:126673891-126673913 CCACGGCCGCAGAGAGGACAGGG - Intronic
1061470761 9:130823607-130823629 CCATGGCCCCTCACAGGCAGTGG + Intronic
1062536733 9:137024330-137024352 CCCTGGCCCCAGGGAGCACGTGG - Intronic
1062591453 9:137276583-137276605 CTCTGGTCCCACAGAGGCCGGGG + Intergenic
1062645240 9:137544412-137544434 CAGTGGCCCCACAGAGGACAGGG - Intronic
1062737791 9:138147864-138147886 CCCTGTCCTCACAGTGGACGCGG - Intergenic
1203775293 EBV:69579-69601 CCATCGCCCCACAGAGAAAGAGG - Intergenic
1186447893 X:9647527-9647549 CCTTGGCCCCAAACAGGAGGGGG - Intronic
1187599494 X:20812115-20812137 CCATGTCCCTACAAAGGACATGG + Intergenic
1190686756 X:52881495-52881517 CCATGTCCCTACAAAGGACATGG - Intergenic
1190801030 X:53789196-53789218 CCATGTCCCTACAAAGGACATGG - Intergenic
1191141886 X:57123307-57123329 CCATGTCCCTACAAAGGACACGG + Intergenic
1192390370 X:70720205-70720227 CCATGTCCCTACATAGGACAGGG - Intronic
1193245523 X:79224215-79224237 CCATGTCCCTACAAAGGACATGG + Intergenic
1193336466 X:80295905-80295927 CCATGTCCCTACAAAGGACATGG - Intergenic
1194825686 X:98560395-98560417 CCATGTCCCTACAAAGGACATGG + Intergenic
1196512809 X:116532299-116532321 CCAAGGCTCCACAGAGAAGGAGG + Intergenic
1196909283 X:120469166-120469188 CCATGACCCCGCAGAGCAGGCGG + Exonic
1197403450 X:126022355-126022377 CCATGTCCCCACAAAGGACATGG - Intergenic
1198711767 X:139511745-139511767 CCATGTCCCTACAAAGGACATGG - Intergenic
1198997113 X:142585877-142585899 CCATGTCCCTACAAAGGACATGG - Intergenic
1199487204 X:148361360-148361382 CCATGTCCCTACAAAGGACATGG - Intergenic