ID: 1029225457

View in Genome Browser
Species Human (GRCh38)
Location 7:99024181-99024203
Sequence ATGTGTACTCTGCTGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029225457_1029225460 -4 Left 1029225457 7:99024181-99024203 CCACCCAACAGCAGAGTACACAT No data
Right 1029225460 7:99024200-99024222 ACATTCTTCTCAAATACACATGG 0: 5
1: 49
2: 285
3: 1000
4: 2495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029225457 Original CRISPR ATGTGTACTCTGCTGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr