ID: 1029225623

View in Genome Browser
Species Human (GRCh38)
Location 7:99026212-99026234
Sequence CTGTGGAAGGTGGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029225613_1029225623 11 Left 1029225613 7:99026178-99026200 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG No data
1029225615_1029225623 -8 Left 1029225615 7:99026197-99026219 CCTGTAATCCCAGCACTGTGGAA 0: 88
1: 12765
2: 310723
3: 261915
4: 145751
Right 1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029225623 Original CRISPR CTGTGGAAGGTGGAGGTGGG TGG Intergenic
No off target data available for this crispr