ID: 1029226685

View in Genome Browser
Species Human (GRCh38)
Location 7:99033821-99033843
Sequence GCCCCAAGTGAGCACCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029226681_1029226685 6 Left 1029226681 7:99033792-99033814 CCCTTCTTGCTCAGGTGTTTCCA 0: 1
1: 0
2: 1
3: 22
4: 259
Right 1029226685 7:99033821-99033843 GCCCCAAGTGAGCACCAGGCTGG No data
1029226682_1029226685 5 Left 1029226682 7:99033793-99033815 CCTTCTTGCTCAGGTGTTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 236
Right 1029226685 7:99033821-99033843 GCCCCAAGTGAGCACCAGGCTGG No data
1029226680_1029226685 7 Left 1029226680 7:99033791-99033813 CCCCTTCTTGCTCAGGTGTTTCC 0: 1
1: 0
2: 3
3: 22
4: 262
Right 1029226685 7:99033821-99033843 GCCCCAAGTGAGCACCAGGCTGG No data
1029226679_1029226685 12 Left 1029226679 7:99033786-99033808 CCAGGCCCCTTCTTGCTCAGGTG 0: 1
1: 0
2: 3
3: 30
4: 272
Right 1029226685 7:99033821-99033843 GCCCCAAGTGAGCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029226685 Original CRISPR GCCCCAAGTGAGCACCAGGC TGG Intronic
No off target data available for this crispr