ID: 1029226777

View in Genome Browser
Species Human (GRCh38)
Location 7:99034202-99034224
Sequence GGGCCCTGGCCACTCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 492}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029226772_1029226777 -4 Left 1029226772 7:99034183-99034205 CCTTCAGAGACCTCCTGCAGGGC 0: 1
1: 0
2: 1
3: 30
4: 255
Right 1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG 0: 1
1: 0
2: 8
3: 46
4: 492
1029226769_1029226777 7 Left 1029226769 7:99034172-99034194 CCAGGTGAGGGCCTTCAGAGACC 0: 1
1: 0
2: 1
3: 3
4: 156
Right 1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG 0: 1
1: 0
2: 8
3: 46
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029226777 Original CRISPR GGGCCCTGGCCACTCTGCCC GGG Intronic
900124854 1:1064790-1064812 CGCACCTGGCCACCCTGCCCCGG - Intergenic
900343035 1:2197584-2197606 GGGCCCTGGCTCCTCTTCCCTGG - Intronic
900389256 1:2427000-2427022 GGGCCTCTGCCACTCTGCCAGGG - Intronic
900490188 1:2944144-2944166 CGGTCCTGGGCACTCTGACCTGG - Intergenic
900521210 1:3106324-3106346 GTGCCCCGGCCCCTCTGCCCAGG - Intronic
900754871 1:4426387-4426409 AGGCCCTGGCTGCTCTGTCCAGG + Intergenic
900990473 1:6096158-6096180 GGGGCCAGGCCACGTTGCCCTGG - Intronic
901063813 1:6485613-6485635 GGGCCCTCGCCACCCAGCCCCGG + Intronic
901127999 1:6942902-6942924 GGCCCCTGGGCAGTCTGCTCTGG + Intronic
901229071 1:7631899-7631921 GGCCCCTGTCCTCTCTGCTCTGG - Intronic
901446236 1:9309887-9309909 GGGCCCTGACCAGTCTCCCTTGG + Intronic
901701149 1:11045327-11045349 GGGCCATTGCTGCTCTGCCCAGG - Intronic
901871968 1:12143438-12143460 GGGCCCCACCCACTCTGTCCTGG + Exonic
901885643 1:12221049-12221071 GAACCCTGGCCACGGTGCCCTGG + Intergenic
903353444 1:22731884-22731906 CGGCCCTGGCTTCTGTGCCCTGG - Intronic
903737763 1:25541210-25541232 TGCCCTTGGCCAGTCTGCCCTGG + Intergenic
904299600 1:29545821-29545843 GGACCATGGCCATGCTGCCCAGG - Intergenic
904369271 1:30038229-30038251 GGGCACTGGCCACTGTCCTCTGG + Intergenic
904481789 1:30798578-30798600 GGGCAGTGGCCACTCAGCTCTGG - Intergenic
904858310 1:33516521-33516543 GGGCACTGGGCACTGTGCTCAGG + Exonic
904989533 1:34580537-34580559 GAGCACTGGCCTCTCTCCCCTGG + Intergenic
905554698 1:38873102-38873124 GGGCTCTGGCCACTGACCCCCGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905930011 1:41780277-41780299 GGGCCTTGGCCACTCTGCCAAGG + Intronic
906821371 1:48933960-48933982 GAGCCCTTGCCTCTCTCCCCAGG + Intronic
907412185 1:54290579-54290601 GGGCCCTGCCCATTCATCCCAGG + Intronic
907954735 1:59217324-59217346 GAGGCCAGGCCACTCTGCCATGG + Intergenic
908501228 1:64745248-64745270 GGGCCCTGCCCGCGCAGCCCCGG - Exonic
908794315 1:67816306-67816328 GTGCCCTTTGCACTCTGCCCAGG - Intronic
911208543 1:95117281-95117303 GGGCCCCGCCCACTTTGGCCAGG + Intergenic
913552450 1:119928938-119928960 GCCTCCTGGCCACTCTGCCTTGG - Intronic
914263551 1:146019396-146019418 GGGCTCCGGCCTCCCTGCCCCGG - Exonic
914393556 1:147242987-147243009 GGGCCGTGGCCACCAAGCCCGGG - Intronic
915283726 1:154839758-154839780 GGGCCCTGGCCACTGGCCACTGG + Intronic
915349094 1:155213417-155213439 GATCCCTGCCCACTCTCCCCAGG - Intronic
915352281 1:155234044-155234066 GATCCCTGCCCACTCTCCCCAGG - Intergenic
915442319 1:155952698-155952720 TGGCCCTGCCCACCCTGCCCAGG - Exonic
916089874 1:161299535-161299557 GGGCCCAGGCCACAGGGCCCAGG + Intergenic
916089878 1:161299549-161299571 GGGCCCAGGCCACAGCGCCCAGG + Intergenic
917632757 1:176905988-176906010 GGGCCATGGCCACTAGGCCGAGG + Intronic
918068088 1:181115144-181115166 TAGCCTTGGCCTCTCTGCCCTGG - Intergenic
919620826 1:199862846-199862868 GGGACCTGGCCATTCTGCTGTGG - Intergenic
919768863 1:201144453-201144475 CAGCCCTAGCCACTCTGCTCAGG - Intronic
919891503 1:201978680-201978702 GAACCCTGGCCACAGTGCCCTGG - Intergenic
919979022 1:202630851-202630873 GGGCTCTGGCCTCCCTGCTCTGG + Intronic
920261886 1:204693916-204693938 AGCTCCTGCCCACTCTGCCCAGG - Intergenic
920308682 1:205035191-205035213 GGGCCTTTGCCACTATGCTCAGG + Intergenic
920364213 1:205439611-205439633 GGGCCTTGCCCTCTCTACCCAGG + Intronic
921075433 1:211696823-211696845 TTGCCCTGGCCTCCCTGCCCAGG - Intergenic
922722372 1:227905532-227905554 CAGCGCTGGCCACCCTGCCCAGG + Intergenic
922744982 1:228038512-228038534 GGCCCCTGGCCAGTCTGGTCAGG + Intronic
922753649 1:228082560-228082582 GGGCCGGGGACACCCTGCCCCGG - Intergenic
1063010741 10:2019859-2019881 GGTCCCTTGTCACTCGGCCCCGG + Intergenic
1063263005 10:4411276-4411298 GGGAGCTGGCCACTCCACCCTGG + Intergenic
1066620912 10:37348891-37348913 GGCCCCTTGTCACTCTGCTCAGG - Intronic
1067052531 10:43030252-43030274 TTGCCCTGGCCCCCCTGCCCTGG - Intergenic
1067318809 10:45198545-45198567 GCGCCCTGGCCGCCCTCCCCCGG + Intergenic
1067742705 10:48908014-48908036 GATCCCTGGCCATTCTGCCTAGG + Intronic
1069594394 10:69661210-69661232 GGGCCGTGTCCAGTCTGCCAGGG + Intergenic
1070140275 10:73733253-73733275 CGGCCCTGGCCAGCCGGCCCCGG + Intergenic
1070719394 10:78745775-78745797 GGGCCTGCCCCACTCTGCCCTGG - Intergenic
1073123582 10:101136264-101136286 TGGTCCTTGCCTCTCTGCCCTGG + Intronic
1073241188 10:102059316-102059338 AGGCCCGGGCCACCATGCCCGGG + Intergenic
1073670267 10:105579919-105579941 GGACCCTCCCCATTCTGCCCAGG + Intergenic
1074242369 10:111651928-111651950 GGTCACTGGCCACTCTTCCTTGG + Intergenic
1074383332 10:112997610-112997632 GGTCCCTGGTCACTCTTCCTGGG - Intronic
1074766255 10:116702216-116702238 TGGCCCTGGCCTCTCTGCAGTGG - Intronic
1076262417 10:129078322-129078344 GGCCCTTGGCATCTCTGCCCTGG - Intergenic
1076348149 10:129794865-129794887 CAGCACTGGCCCCTCTGCCCGGG - Intergenic
1076674844 10:132142488-132142510 CGGCCCCGGCCCCTCTCCCCCGG + Intronic
1077010368 11:376756-376778 GCGCCCTGGCCGCCCTTCCCTGG + Exonic
1077044269 11:537561-537583 CGGCCCTGGCAGCTCGGCCCTGG - Exonic
1077049104 11:558803-558825 GGCCCCTGGCCACCTGGCCCAGG + Intronic
1077225598 11:1437868-1437890 GGCCCCTCCCCACACTGCCCAGG - Intronic
1077231435 11:1459689-1459711 GGGCCCTGTGCTCACTGCCCAGG - Intronic
1077307746 11:1875581-1875603 GGACCCTAGCCTCTCTGCCTGGG - Intronic
1078549396 11:12269898-12269920 GGCCTCTGGCTCCTCTGCCCTGG - Intergenic
1079098836 11:17528266-17528288 GGGCCCTGGGCAGCCAGCCCTGG + Intronic
1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG + Intronic
1083290277 11:61686116-61686138 GGGCAGTGGCCACTCTGCAGGGG + Intronic
1083609767 11:63999272-63999294 GGGGGCTGGTCACTCTGGCCGGG + Intronic
1083642185 11:64151415-64151437 AGGCCCTGGCCCCTGGGCCCTGG - Intronic
1083718264 11:64591484-64591506 TTGCCCTGGCCTCTTTGCCCTGG + Exonic
1083856773 11:65396865-65396887 CGGCCCTGGCCCCACGGCCCCGG - Exonic
1083882670 11:65556116-65556138 GCTCCCTGGCCATCCTGCCCAGG - Intronic
1083992821 11:66257574-66257596 GGGCCCTGGGAACTGCGCCCCGG + Intronic
1084146571 11:67268058-67268080 GGGGCCTGTCCACACTGCCGTGG + Intronic
1084284526 11:68122299-68122321 GGGCCCTTGCCCCTCTACCCCGG - Intergenic
1084431910 11:69115911-69115933 CGGCACTGGCCTCTGTGCCCTGG + Intergenic
1084649689 11:70481941-70481963 GTGCCCTGGCAACTCCGTCCTGG + Intronic
1085203193 11:74714098-74714120 GGGTGGTGGCCACTCTGCCTCGG - Intronic
1085385216 11:76153715-76153737 GGGCTGTATCCACTCTGCCCTGG + Intergenic
1085507787 11:77069988-77070010 GGGACCTGGCCCCTTTGCCTTGG - Intronic
1086174939 11:83880074-83880096 TACCCCTGGCCACTCTGCTCTGG - Intronic
1089338841 11:117744269-117744291 GGACGCAGGCCACACTGCCCAGG - Intronic
1089696314 11:120218371-120218393 GCACCCTGGCTGCTCTGCCCAGG - Intronic
1089783702 11:120892870-120892892 GGTCCCTGGCTGCTCTACCCAGG + Intronic
1090703527 11:129316490-129316512 GAGCCATGGCCCCTCTGCCTAGG + Intergenic
1090779268 11:129992503-129992525 GGGTCCTGGCCACTTTGCCTAGG - Intronic
1202807853 11_KI270721v1_random:14528-14550 GGGCCCTCCCCACACAGCCCTGG - Intergenic
1091409955 12:232864-232886 GTCTCCTGGCCACTCTGGCCAGG - Intronic
1091768533 12:3137282-3137304 GGGCCCTGCCCACGTTTCCCCGG + Intronic
1091790586 12:3269843-3269865 AGCCCCTGGCCCCACTGCCCAGG + Intronic
1091828949 12:3535635-3535657 TGGCCCTGCCTGCTCTGCCCTGG - Intronic
1092244581 12:6856453-6856475 GAGGCCTGGCCCCTCTGCCTCGG + Intronic
1093005139 12:14043410-14043432 AGGCCCTTGACCCTCTGCCCTGG + Intergenic
1096096483 12:48938843-48938865 GGGCCCTGGCCACACTTGCATGG + Exonic
1096554837 12:52397012-52397034 GGGCTCTGACCTCTCTGTCCTGG - Intronic
1097189932 12:57214752-57214774 GGTCCCTTGTCGCTCTGCCCAGG - Intergenic
1097686270 12:62693895-62693917 GAGCCCTGTCCTCTCTACCCAGG + Intronic
1098150132 12:67538115-67538137 GGGCCCTGGTCACTTTTCCAAGG + Intergenic
1098257029 12:68627127-68627149 GAACCCTGGCCACAGTGCCCTGG + Intronic
1100885661 12:99067068-99067090 GTGCCCTGGCCAGTCTCCCATGG + Intronic
1101371774 12:104137712-104137734 GGGCCCTGGCCCCGTAGCCCCGG - Intronic
1101952452 12:109187221-109187243 GGGCCCTGCCCAGGATGCCCTGG + Intronic
1101989931 12:109476632-109476654 GGCCCCTGGCATCTCTCCCCAGG + Intronic
1102034044 12:109760853-109760875 AGGCCCTGGCCACCTGGCCCAGG - Intronic
1102246887 12:111361817-111361839 GGGCCATGGCTACCCAGCCCAGG + Exonic
1102877017 12:116456828-116456850 GGTCACTGGCCAGTCTGCCAGGG + Intergenic
1104024158 12:125014022-125014044 ACACCCTGGGCACTCTGCCCGGG - Intronic
1104970452 12:132528454-132528476 GGGCCCAGGCCTTTCTGTCCGGG - Intronic
1104989197 12:132615616-132615638 GGACACTGTCCACTCTCCCCTGG + Intergenic
1105208963 13:18246776-18246798 GGACCCTGGCCACACTGCCACGG - Intergenic
1105418509 13:20232675-20232697 GGGCCCAGCCCCCTCTGCACGGG + Intergenic
1105885508 13:24638097-24638119 GGGCCCAGCGCACTCTGCCAGGG - Intergenic
1106092047 13:26604984-26605006 GGACCCTGGCGCCTCTGTCCAGG - Intronic
1106325557 13:28685300-28685322 GGGGTCTGGCCACTGTGCACAGG - Intergenic
1106591872 13:31105149-31105171 GCTCCATGGCCACTCTGCACAGG + Intergenic
1109561181 13:64052482-64052504 GGACCCTGGCCCCTCTTCCTGGG - Intergenic
1112434515 13:99382508-99382530 GGGCAGTGGCCTCACTGCCCTGG + Intronic
1113375436 13:109761112-109761134 GGGTCGTGGCAGCTCTGCCCAGG + Intronic
1113635001 13:111913362-111913384 TGGCCCTGTGCACTCTTCCCAGG - Intergenic
1113940864 13:114018063-114018085 GGGTCCAGGCCGCTCTCCCCCGG + Intronic
1114898264 14:27022400-27022422 AGGCCTGGGCCACTGTGCCCGGG - Intergenic
1116889655 14:50255753-50255775 GGGCCTGAGCCACCCTGCCCAGG - Intronic
1117316298 14:54574122-54574144 GGGCCCTGGGCTCTCTGCTGGGG - Intronic
1117338936 14:54777589-54777611 GGACTCTGGCCACTCTCCCTGGG + Intronic
1118729801 14:68658313-68658335 GGGCTCAGGACACTCAGCCCTGG + Intronic
1118776620 14:68978023-68978045 TGCCACTGGCCACTGTGCCCGGG + Intronic
1119665808 14:76484303-76484325 GGCCCCTGGGCATTCTGACCAGG + Intronic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1121266214 14:92604159-92604181 GGGCCATGCCCACTCTTCCATGG - Intronic
1122026316 14:98880102-98880124 CTGCTCTGTCCACTCTGCCCTGG + Intergenic
1122255546 14:100473162-100473184 GGGCCCTGGGCTATGTGCCCTGG + Intronic
1122638134 14:103139697-103139719 CATGCCTGGCCACTCTGCCCTGG + Intergenic
1122718397 14:103708493-103708515 GGGCCCTGGCATCTCTGCCAGGG - Intronic
1122828997 14:104386603-104386625 ACGCCCTGGCCATGCTGCCCAGG - Intergenic
1122891104 14:104732647-104732669 GGGCACTGGGCACTCTGCCATGG + Intronic
1122974597 14:105165918-105165940 AGTCCCTGGCCATGCTGCCCTGG - Intronic
1123034414 14:105466144-105466166 GGGGCCAGGCCCCTCAGCCCCGG - Intronic
1123058386 14:105583198-105583220 TGGTCCTGGTCACTCAGCCCTGG - Intergenic
1123082633 14:105703051-105703073 TGGTCCTGGTCACTCAGCCCTGG - Intergenic
1123082676 14:105703251-105703273 TGGTCCTGGTCACTCAGCCCTGG - Intergenic
1123082721 14:105703451-105703473 CGGTCCTGGTCACTCAGCCCTGG - Intergenic
1123121698 14:105919727-105919749 GGGCCCAGGCCCCTCTGGGCAGG + Intronic
1123404403 15:20011378-20011400 GGGCCCAGGCCCCTCTGCGCAGG + Intergenic
1123513736 15:21018025-21018047 GGGCCCAGGCCCCTCTGCGCAGG + Intergenic
1124374143 15:29120065-29120087 TGGCCCTCCCCACTCTGCCCCGG + Intergenic
1124494618 15:30178731-30178753 GGGCTCTGGCCTCCCTGCTCTGG + Intergenic
1124649623 15:31465189-31465211 GGGCGGTGGCCACTTTCCCCTGG - Intergenic
1124665426 15:31587804-31587826 GGGCTCCAGCCACTCTGACCTGG + Intronic
1124748952 15:32359914-32359936 GGGCTCTGGCCTCCCTGCTCTGG - Intergenic
1124972059 15:34496897-34496919 GGGCCCTGGCGGCTCACCCCAGG - Intergenic
1125151726 15:36540196-36540218 CAGCCCTGGTGACTCTGCCCAGG - Intergenic
1125950810 15:43749746-43749768 GGGGTCTGGCCATGCTGCCCAGG - Intronic
1127070672 15:55285871-55285893 TGGCCCTGCCCAGTTTGCCCAGG + Intronic
1127386964 15:58474720-58474742 GTTCCCTGGCCTCTCTGCCCAGG + Intronic
1127727218 15:61761764-61761786 AGACCCTTGCCACTCTGCACTGG - Intergenic
1128264227 15:66253450-66253472 GGACCCCGGCCGCCCTGCCCGGG - Intronic
1129455284 15:75673454-75673476 GGGCCCTGGTCACCCTCCCTGGG + Intergenic
1129696107 15:77741478-77741500 GGCCCCTGGCCACCCTTCCCTGG + Intronic
1130015204 15:80180773-80180795 GGGCACTGGGCACTCTGGTCAGG + Intronic
1130046620 15:80450768-80450790 GGTCCCTGGGCTCTCTGCGCAGG + Intronic
1131025996 15:89142082-89142104 GGGCCTTGGCCACTGCGTCCAGG - Intronic
1131425766 15:92344368-92344390 GGCCCCTGGCCAGCCTGCTCAGG + Intergenic
1131509899 15:93044165-93044187 GGGCCCAGGCACCCCTGCCCAGG + Intronic
1131747875 15:95469235-95469257 GGAGCACGGCCACTCTGCCCTGG + Intergenic
1132330999 15:101012630-101012652 GTGGCCTGGGCACTCTGCCTGGG - Intronic
1132331001 15:101012640-101012662 GTGCCCAGGCCACCCTGCACAGG + Intronic
1132513191 16:353903-353925 GGGCCCGTGCCTCTCTGCCGTGG - Intergenic
1132519616 16:381366-381388 GGGCCCAGGGGACTCTGCCCGGG - Intronic
1132544741 16:527972-527994 GGGCCGGGGCCGCGCTGCCCGGG + Exonic
1132544820 16:528167-528189 GGGCCCTGCCGTCCCTGCCCTGG - Intronic
1132582692 16:692794-692816 GGCTCCTGACCACTCAGCCCTGG + Exonic
1132614187 16:832182-832204 GGGGCCTGTGGACTCTGCCCCGG + Intergenic
1132617243 16:847808-847830 GGCCCCTGGCCAGGCGGCCCAGG + Intergenic
1132636884 16:954194-954216 GTGCACTGGCCGCTCTGCCATGG + Intronic
1132667534 16:1089077-1089099 TGGCCCTGGCCCGGCTGCCCTGG - Intergenic
1132846109 16:2001632-2001654 CAGCCCGGGCCACTCGGCCCTGG + Exonic
1133809996 16:9154475-9154497 GCCCCCTGGCTACACTGCCCTGG - Intergenic
1136146178 16:28317824-28317846 GTACCCTGGCCACTCTGCCCCGG - Intronic
1137496569 16:48973765-48973787 AGGACCTGTCCACTCAGCCCTGG - Intergenic
1137654864 16:50151535-50151557 GAACCCTGGCCACAGTGCCCTGG + Intergenic
1137718291 16:50612236-50612258 GGGCCTGGGCCAGTCTGTCCAGG + Intronic
1138534487 16:57652798-57652820 AGGCTCGGGCCCCTCTGCCCAGG - Intronic
1138560499 16:57798168-57798190 GGGCCCGGCCCACTCTCCACAGG + Exonic
1139093518 16:63677248-63677270 GGATCCTGTCCACTCTGCCAGGG - Intergenic
1139517051 16:67458360-67458382 GAGACCTGGCCACCCAGCCCTGG + Intronic
1139950241 16:70664902-70664924 GGGCCCTGGCCAGCCTACCTTGG + Exonic
1140078665 16:71724035-71724057 GCGCCCGGGCCACTCGGCGCCGG - Intronic
1140136349 16:72209083-72209105 TGGGCCTGGACACTCAGCCCCGG + Intergenic
1141462044 16:84183478-84183500 GGACCCTGGCCTGACTGCCCGGG - Exonic
1141598543 16:85111976-85111998 GGACCCAGTCCACACTGCCCCGG - Intronic
1141646643 16:85371200-85371222 AGCCCCTGGCCCCCCTGCCCTGG - Intergenic
1141748465 16:85942221-85942243 AGGCCCTGGCCTCTCTCCCTTGG + Intergenic
1141785070 16:86193955-86193977 GAGCCCAGGTCACACTGCCCGGG - Intergenic
1141848988 16:86631171-86631193 GGGCTCTGCCCACTATGCCGGGG - Intergenic
1142144989 16:88489190-88489212 GGGGCCGGGCCAGGCTGCCCGGG - Intronic
1142325007 16:89409093-89409115 GGGCCCAGGCCAGTGAGCCCTGG + Intronic
1142518697 17:490190-490212 AGGCTCTGGGCCCTCTGCCCCGG + Intergenic
1142744012 17:1946110-1946132 CTGCCCTGGTCACCCTGCCCTGG - Intronic
1143104024 17:4519540-4519562 CGGCCCTGCCCGCTCGGCCCTGG + Intronic
1143211060 17:5187951-5187973 GGGCTCAGGCCATCCTGCCCTGG + Intronic
1143628069 17:8122263-8122285 AGGGCCCGCCCACTCTGCCCCGG + Intronic
1144506264 17:15833971-15833993 GGGCTCTGGAGTCTCTGCCCAGG + Intergenic
1144774605 17:17778930-17778952 GTGCACTGGCCCCTCTTCCCAGG - Intronic
1144782930 17:17816923-17816945 CTGCCCTGCCCACTCTGCCGGGG + Intronic
1145250195 17:21293276-21293298 GTGCCCCAGCCACTCTGCCCGGG + Intronic
1145267175 17:21385514-21385536 GGGACCTGGCCGCTCTGACTGGG - Intronic
1145844048 17:28022231-28022253 GAACCCTGGCCACAGTGCCCTGG + Intergenic
1146125018 17:30224610-30224632 GTTCCCTGGCCTCTCTACCCAGG + Intronic
1146289313 17:31596639-31596661 GGGCCCTGGCCAGCCTTGCCGGG + Intergenic
1146915416 17:36675374-36675396 GTGCCCTGGCAAATGTGCCCTGG - Intergenic
1147360007 17:39924507-39924529 GGGCCTTGACTTCTCTGCCCTGG - Intronic
1148550408 17:48546888-48546910 TGTCGCTGGCCACTTTGCCCAGG - Intergenic
1148562098 17:48612074-48612096 GCGCCCTGGCCTCCCTGGCCGGG + Intronic
1148755162 17:49969435-49969457 GGGCCATGGCCCTTCTGCCCGGG + Exonic
1149318227 17:55458731-55458753 CTGCCCTGGCCAGACTGCCCTGG - Intergenic
1149494857 17:57110940-57110962 GGGCCCTGGGCTCTGTGCTCAGG + Intronic
1150552557 17:66224277-66224299 GGGCCTTTGCCACATTGCCCAGG - Intronic
1150654856 17:67033037-67033059 GGGCCCTGCTTACTCTGCCTGGG - Exonic
1150861367 17:68804139-68804161 GGGCCCTTGCCATGATGCCCAGG - Intergenic
1150920306 17:69475762-69475784 GGGCCCTGGCCTCTGGTCCCAGG + Intronic
1151555872 17:74846433-74846455 GTCCCCTGGCCACTCTGCAGAGG - Intronic
1152078295 17:78171645-78171667 GGCCCCTGGCCATCCTACCCAGG - Exonic
1152121481 17:78421520-78421542 GCGGCCTGGCCACAGTGCCCTGG + Intronic
1152238487 17:79150278-79150300 GGGCCCAGGCCACTCTGCTTGGG + Intronic
1152592843 17:81222320-81222342 GGGCTCTGGCCTCTCTGTCCAGG - Intronic
1152657750 17:81527850-81527872 GGCCTCTGGCCACACTGCTCAGG - Intergenic
1152707979 17:81855113-81855135 GGCCCCAGGCAGCTCTGCCCAGG - Intronic
1153547150 18:6219589-6219611 GGGCGTCGGCCACTCAGCCCTGG + Intronic
1155526050 18:26717264-26717286 GGGCCCCTGACACTTTGCCCAGG + Intergenic
1155654239 18:28176763-28176785 TGGCCCCGGCAACCCTGCCCCGG + Intronic
1156138903 18:34080660-34080682 GGGCTCTTGCTACACTGCCCAGG + Intronic
1156864456 18:41873411-41873433 GGGGCCTGGTCACTCTGCTCAGG - Intergenic
1157562724 18:48660083-48660105 GGGCCATGGCCTCTCTCCCCAGG + Intronic
1157562767 18:48660335-48660357 GGGCCATGGTCCCTCTCCCCAGG + Intronic
1157619259 18:49006680-49006702 GGTCCCAGGCCACTAGGCCCCGG - Intergenic
1158944354 18:62435924-62435946 GGGCAGTGGACAGTCTGCCCTGG - Intergenic
1159879589 18:73845888-73845910 TGGCCATGGACACTGTGCCCAGG + Intergenic
1160328778 18:77973747-77973769 GGGCCCTGGCGAGGCTGCCTGGG + Intergenic
1160340791 18:78087138-78087160 GGGCCTCCGCCACACTGCCCAGG - Intergenic
1160501232 18:79401918-79401940 CGGCCCTGGGCCCTCGGCCCTGG + Intronic
1160519711 18:79497681-79497703 GGGCCCCAGCCACTCTTCTCTGG + Intronic
1160683160 19:421725-421747 GGGGCCTTGCCACGTTGCCCAGG - Intronic
1160706709 19:533282-533304 GGGCCCGGCCCGCTCTGCCCCGG + Intronic
1160962333 19:1728452-1728474 CAGCCCTGGCCACTTTGCTCAGG + Intergenic
1161045561 19:2132597-2132619 GGGCCGTGGCCAGGATGCCCTGG + Intronic
1161124934 19:2550573-2550595 GGGCCATGGTCACTCTCCCTGGG - Intronic
1161366136 19:3880834-3880856 GGGCGCTGGCCACGTCGCCCTGG + Exonic
1161420137 19:4171986-4172008 GCTCCCAGGCCCCTCTGCCCAGG + Exonic
1161778883 19:6278838-6278860 AGGCCCTGGTCACTCTCCCTCGG - Intronic
1161979671 19:7623995-7624017 GGGCCCTAGACACTCAGCTCGGG + Intronic
1162306560 19:9878040-9878062 GGGGTCTGGCCACATTGCCCAGG + Intronic
1162510766 19:11116777-11116799 AGGGCCTGGCCACGCTGCTCCGG - Intronic
1162626322 19:11887876-11887898 GGGACCTGGTTCCTCTGCCCAGG + Exonic
1162717563 19:12643532-12643554 GAACCCTGGCCACAGTGCCCTGG + Intergenic
1162919225 19:13890320-13890342 GGGCTCTGGCTGCTCTGCTCAGG + Exonic
1163102905 19:15108445-15108467 GGGCCCTTGTCCCTCAGCCCAGG - Intronic
1163426911 19:17245225-17245247 GCGCCCCGGCCCCGCTGCCCTGG - Exonic
1163852216 19:19670563-19670585 GGGGTCTCGCCACTTTGCCCAGG - Intronic
1164664021 19:30011177-30011199 TGGCAGTGGCCACTCTGCCCAGG + Exonic
1165091999 19:33392519-33392541 GGCCCCAGGACACTCTGGCCAGG + Intronic
1165094812 19:33404304-33404326 TGGCCCTGTCCTCTCTGCCCAGG - Intronic
1165165321 19:33849803-33849825 GGGCCCTGGACAGTGTGCACAGG - Intergenic
1165320767 19:35083888-35083910 GAGCCCTGATCACTCTGCCGTGG - Intergenic
1166069163 19:40377403-40377425 TGGCCCTGACCCCTCTGCCTGGG - Intronic
1166120122 19:40681283-40681305 TGGCCCTGACCCCTCTGCCTGGG - Intronic
1166141007 19:40805206-40805228 CTGCCCTGACCTCTCTGCCCTGG - Intronic
1166194200 19:41195461-41195483 TGGCCCTGACCACTCTGGGCTGG - Intronic
1166933106 19:46313429-46313451 GGGTCCTAACCACTTTGCCCAGG - Intronic
1168169079 19:54574456-54574478 GGGAACTGGCCATTCTTCCCAGG - Exonic
1168304059 19:55424834-55424856 GGGCCCTGGCTGATCTGCCTGGG + Intergenic
1168667656 19:58216890-58216912 GGGCCCTGGTCAGCCTCCCCAGG - Intergenic
925048169 2:790117-790139 GGGACCTGTCCCCTCTGCTCAGG - Intergenic
925196997 2:1933708-1933730 GGGCACTGGGCACCCTGTCCTGG - Intronic
926695523 2:15767815-15767837 TGGCCCACGCCACCCTGCCCAGG + Intergenic
926907262 2:17817067-17817089 GGGCTCTGGGCTCTCTGCCGCGG - Exonic
927016737 2:18971207-18971229 GGGAACTGTCCACACTGCCCAGG - Intergenic
927636278 2:24819635-24819657 GGGCCCTGACCACTGTGAGCAGG - Exonic
927722935 2:25398413-25398435 GGGCCCTGACAGCTCTGTCCTGG - Intronic
927857186 2:26535121-26535143 GGGCTGAGGCCACTTTGCCCAGG + Intronic
927927911 2:27026054-27026076 GGGCCCTCCCCAGTCTGGCCTGG + Intronic
927973731 2:27322470-27322492 GGGCCCTGGCCGCTCACCCGTGG - Exonic
929811342 2:45191434-45191456 CGCCCCTGCCCACTCTGGCCGGG - Intergenic
931342706 2:61417137-61417159 GAACCCTGGCCACAGTGCCCTGG + Intronic
932773213 2:74513266-74513288 GGGCCCTGGCGCCTCTGAGCCGG - Intergenic
934105541 2:88691736-88691758 GGGTCTTGGCCCCGCTGCCCGGG + Exonic
934119172 2:88823728-88823750 CAGCCCTGGCCACCCTGCCTGGG - Intergenic
934515839 2:94985869-94985891 CAGCCCTGGCCACCCTGCCTGGG + Intergenic
935612212 2:105037673-105037695 GGGCCCCGGCCGCCCTGCCCAGG + Intergenic
936906120 2:117537130-117537152 GTGCCCTGGCTACTCACCCCTGG + Intergenic
937314539 2:120922677-120922699 GGCACATTGCCACTCTGCCCTGG + Intronic
938064026 2:128271503-128271525 GGGCCCTGGCTCCTCAGCTCTGG + Intronic
938694881 2:133826187-133826209 GGGCCCTGCACACTATGCCAGGG - Intergenic
939629829 2:144517484-144517506 GGGCCCTGGCCCGGCTCCCCTGG - Intronic
939632663 2:144543977-144543999 GAGCCCTGGGCACTGTGTCCTGG - Intergenic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
945837169 2:214847166-214847188 GAACCCTGGCCACAGTGCCCTGG - Intergenic
946414311 2:219531943-219531965 GGGGCCTGGGCCCTCTGCCTGGG + Intronic
946417517 2:219547818-219547840 GTGCCCTGCTCACTCTGCGCTGG + Exonic
947714315 2:232332140-232332162 GGGCCCTGGCCCCTCTTGGCTGG - Intronic
947733523 2:232443519-232443541 GGGCCCTGGCCCCTCTTGGCTGG - Intergenic
948449472 2:238060514-238060536 GGGCCCTGGCCCTGCTGCCGCGG + Intronic
948619921 2:239227863-239227885 GGGCCCGGGCCACCCTGCAGTGG - Intronic
948666262 2:239536480-239536502 GGGCGGGGGCCACTGTGCCCAGG - Intergenic
948897404 2:240933861-240933883 GGGCCCTGCCCACCCAGCCACGG - Intronic
949078191 2:242074686-242074708 GGGCTCTCGCCACGTTGCCCAGG - Intergenic
1168736894 20:148192-148214 GGGCCCTGCCCACTGGGCCTTGG + Intergenic
1169118283 20:3081277-3081299 GGGCCCTGACCCCAATGCCCAGG - Intergenic
1169214110 20:3783948-3783970 AGCCCCAGGCCCCTCTGCCCAGG + Exonic
1169833537 20:9852524-9852546 AGGCTCTGGCCACATTGCCCAGG - Intergenic
1169899888 20:10542228-10542250 GTGCACTGGCCACTCAACCCAGG - Intronic
1172393142 20:34580230-34580252 TGTCACTGGCCACTCTGCCGAGG + Intronic
1174088358 20:48026563-48026585 GGGGTCTGGCCATGCTGCCCAGG + Intergenic
1174516940 20:51099980-51100002 GGTCCCTGGCCACTGGGCCCTGG + Intergenic
1175173044 20:57093126-57093148 GGCACCTGGCCTCCCTGCCCAGG - Intergenic
1175228887 20:57461075-57461097 AGGCCATGTCCACTCTGTCCTGG - Intergenic
1175389666 20:58619093-58619115 AGCCCAGGGCCACTCTGCCCAGG + Intergenic
1175844135 20:62049739-62049761 GGGCTCTGGAACCTCTGCCCGGG - Intronic
1175910941 20:62405286-62405308 AGGGCCTTGCCGCTCTGCCCTGG + Intronic
1175914566 20:62419663-62419685 TGGCCCGGGCCCCTCTGCGCTGG + Exonic
1176109883 20:63406369-63406391 CTGCCCTGTCCACTCTGCTCAGG - Exonic
1176145527 20:63563718-63563740 GGGCTCTGCCTACTCTGCCAGGG - Exonic
1176181706 20:63752512-63752534 GGCCCCTGTCTGCTCTGCCCCGG - Intronic
1176229342 20:64023828-64023850 GGGCACTGCCCACTGTGCCCAGG - Intronic
1178937548 21:36876096-36876118 GGGGTCTGGCCACTGTGCACAGG - Intronic
1179067668 21:38041489-38041511 AGGCACTGGAAACTCTGCCCAGG - Intronic
1179167246 21:38944624-38944646 GGGCACTGCCCACTGTCCCCCGG - Intergenic
1179549570 21:42135478-42135500 TGGCCCTGGACTCTCAGCCCTGG - Intronic
1179822124 21:43943019-43943041 GCACCCTGGCCACCCAGCCCTGG - Intronic
1179880712 21:44292355-44292377 GGGCCGGGGCTCCTCTGCCCGGG - Exonic
1180831998 22:18911231-18911253 GGGCACTGCCCACCCTCCCCAGG + Intronic
1181543063 22:23584196-23584218 GGGCCCAGCCTCCTCTGCCCAGG - Intergenic
1182070660 22:27461523-27461545 GGGTCCTGGCCACCTTGCCTGGG + Intergenic
1182317053 22:29454590-29454612 TGGCCCTGGGCATCCTGCCCTGG - Intergenic
1182435504 22:30327047-30327069 GGGCCCCGCCCACCCTCCCCCGG + Intergenic
1182585658 22:31343129-31343151 AGGCCCAGGCCTCTCTGCCCTGG + Intronic
1182772427 22:32804939-32804961 CGGCCCGGGCAAATCTGCCCTGG + Intronic
1183213575 22:36465503-36465525 GGGGTCTGGCCTCTCTGCCCGGG - Intergenic
1183351713 22:37338241-37338263 AGGTCCTGGCCCCACTGCCCCGG + Intergenic
1183357482 22:37367422-37367444 GGGCCCAGGACAGGCTGCCCAGG + Intergenic
1183522428 22:38303253-38303275 GGTCCCTTGCCTCCCTGCCCCGG - Intronic
1183525341 22:38319295-38319317 GTGCCCAGGCCTCTCTGCCTGGG - Intronic
1183735375 22:39642120-39642142 CTGCCCTGGGCACTTTGCCCTGG + Intronic
1184374663 22:44104076-44104098 GTGCCCTGGCCACTGGGGCCAGG + Intronic
1184840256 22:47048378-47048400 GGGGCCTGACCACCCTGTCCTGG - Intronic
1184982840 22:48106475-48106497 GGGCTCTGGCCACTCTGCCTCGG + Intergenic
1185221408 22:49630797-49630819 GGGCCCTGGGCACCCTCCGCAGG + Intronic
1185377670 22:50489608-50489630 AGGACCTGGCCATGCTGCCCTGG + Exonic
1203282076 22_KI270734v1_random:136502-136524 GGGCACTGCCCACCCTCCCCAGG + Intergenic
950100456 3:10353437-10353459 GGGAACTGTCCACTCTGCACTGG + Intronic
950354900 3:12398992-12399014 TGGCTCTGGCCTTTCTGCCCAGG - Intronic
950363678 3:12468097-12468119 GGGCCTTGTCCCCTCTGCTCTGG - Intergenic
950458245 3:13105345-13105367 GGGTCCTGGCCACACATCCCAGG + Intergenic
950499650 3:13355541-13355563 GGGGCCTGGCCAGGCTGCCATGG - Intronic
950526779 3:13528967-13528989 ATGCCCTGGCCACTCCTCCCTGG + Intergenic
952899750 3:38102184-38102206 GGGCCCTTCGCACTCTGCCTTGG + Intronic
952942139 3:38453641-38453663 GGCTCCTGACCACTTTGCCCGGG - Intergenic
952954650 3:38549514-38549536 GGACCCAGGCCACTCTCCTCTGG + Exonic
952961798 3:38596734-38596756 GGATCATGGCAACTCTGCCCTGG + Intronic
954406088 3:50345740-50345762 GGGCCCAGGCCGCACTGCGCAGG - Exonic
954628571 3:52036087-52036109 GGTGCTAGGCCACTCTGCCCTGG - Intergenic
954661714 3:52230114-52230136 GGGCCCAGGCCCCTCTCCCCAGG + Intronic
955312248 3:57900919-57900941 AGGCCGTGAACACTCTGCCCTGG + Intronic
957146718 3:76434416-76434438 GGGCCATAGCCACCCAGCCCAGG - Intronic
960620887 3:119635773-119635795 GAACCCTGGCCACAGTGCCCTGG + Intergenic
961826749 3:129603231-129603253 GGCCCTTCGCCACTCTGTCCTGG + Intronic
962472241 3:135720743-135720765 GGGCACTGGGCACTGGGCCCTGG - Intergenic
964711291 3:159674403-159674425 GGCCCCTGGGCACTCTGCATGGG - Intronic
966520363 3:180868161-180868183 TGGACCTGGCCACTCTTCTCTGG + Intronic
966735156 3:183181729-183181751 GGTCCATGGCCTCTGTGCCCCGG + Intronic
966767937 3:183479155-183479177 GGTCCATGGCCTCTGTGCCCTGG - Intergenic
967887466 3:194342771-194342793 ATGCCCTGGTCACTGTGCCCTGG - Intronic
967887467 3:194342785-194342807 GTGCTCTGGTCACTATGCCCTGG - Intronic
968286229 3:197510376-197510398 GGGCACTGGGGACCCTGCCCCGG + Exonic
968516945 4:1019440-1019462 GGGCCTTGGCCACTCCCCCTTGG + Intronic
968553474 4:1236110-1236132 GGGCCTTGCCAACTCTGGCCTGG - Intronic
968564821 4:1306048-1306070 GGGCCCTGCCCAATCTGCTGAGG - Intronic
968698625 4:2044327-2044349 TGGCCCTGCCCTCTCTCCCCGGG - Intergenic
968816620 4:2824823-2824845 GGGCGCTGGCCTCTCAGCCCCGG + Intronic
968866042 4:3212582-3212604 AGTCCCTGCCCACTCTGGCCCGG + Exonic
968926454 4:3551047-3551069 AGGCCCGGTGCACTCTGCCCAGG + Intergenic
969049097 4:4360068-4360090 AGGCGCTGGCCACCATGCCCTGG + Intronic
969305685 4:6325109-6325131 GGGCTCTGGCCAGTCCGCCTGGG + Intronic
969511635 4:7621138-7621160 TGGGCCTGGTCACACTGCCCAGG - Intronic
969620057 4:8274326-8274348 CTGCCCTGGCCACTGTGCCCAGG + Intronic
969703296 4:8779377-8779399 GTGCCCTGTCCATTCTGCCCCGG - Intergenic
969787866 4:9473517-9473539 GGGTCCCGGCCCCTCTGCCATGG - Intergenic
970616342 4:17771730-17771752 CTGCCCTGGCCTCTCAGCCCAGG + Intronic
971223549 4:24730983-24731005 GGGTGCTGGACACTCTTCCCTGG - Intergenic
973705271 4:53574663-53574685 GGGCTCTGGACACTTTGCCTGGG + Intronic
975122935 4:70748841-70748863 CGGCCCTGACCACTCTTTCCTGG - Intronic
975758436 4:77594564-77594586 GAGCCCAGGCCACTGTGCCTGGG - Intronic
978408063 4:108400173-108400195 TGGCTCTGGCCTCACTGCCCTGG - Intergenic
979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG + Intergenic
984758868 4:183347218-183347240 GGGCACTGGCCACTCTGTCAGGG + Intergenic
985124839 4:186682976-186682998 GGGCCCTGGACTGACTGCCCTGG + Intronic
985198253 4:187456413-187456435 GTGCCCTGGCCACTCTCCTCAGG + Intergenic
985636409 5:1037961-1037983 GGGCCCTGGACACGCAGCCCCGG + Exonic
985964465 5:3329523-3329545 GGGCCCAGGCCACTCTGCAGAGG + Intergenic
985988308 5:3535743-3535765 GGGCCCTGACCACACTGACCTGG + Intergenic
986220772 5:5766974-5766996 GGGGCATGGCCACACTTCCCTGG + Intergenic
986826008 5:11523806-11523828 TGCCCTTGACCACTCTGCCCTGG + Intronic
988173482 5:27690279-27690301 GGGCCCTGGGAATTCTGACCTGG + Intergenic
988993434 5:36692961-36692983 GGGCCCGGGCCTCTGCGCCCGGG + Intergenic
992639139 5:78753276-78753298 GGGAGCTGGTCAGTCTGCCCTGG - Intronic
992749573 5:79849801-79849823 GAACCCTGGCCACTGTGCCCTGG + Intergenic
992997375 5:82346714-82346736 GGAGCCTGGCCTCTCTGCCCTGG + Intronic
997598139 5:135120848-135120870 GTGCCCTTGCCACCATGCCCTGG + Intronic
997969779 5:138391771-138391793 GGGCCCAAGCCTCTCTGCCATGG + Exonic
998250336 5:140548125-140548147 GGGCCCTGGCCCCTATTCCTAGG - Intronic
998429501 5:142058734-142058756 GGGCCCTGCCCACTTTCCCTTGG - Intergenic
1000019875 5:157309881-157309903 GGCCCCTCGGCTCTCTGCCCGGG - Intronic
1001057987 5:168465027-168465049 GAGCTCTGGCCTCTCTTCCCCGG - Intronic
1001389350 5:171366337-171366359 GAACCCTGGCCACAGTGCCCTGG - Intergenic
1001983039 5:176049378-176049400 GGGGTCTTGCCACACTGCCCAGG + Intergenic
1002234426 5:177794674-177794696 GGGGTCTTGCCACGCTGCCCAGG - Intergenic
1002436373 5:179234372-179234394 GGGCCCAGTCCACCGTGCCCTGG + Intronic
1002640010 5:180626270-180626292 GGGCCCTGACCTCCCTTCCCTGG - Intronic
1003497866 6:6679779-6679801 GGGCCCTGGGCTCCCTGCCAGGG + Intergenic
1004395686 6:15245235-15245257 GGGCCCCGGCCCCCCTCCCCTGG - Intergenic
1004441889 6:15662434-15662456 GGGCGCAGGCCACTGTGCCGCGG + Intronic
1004767649 6:18748595-18748617 GGGCCACGGCCCCTCTGCCCAGG - Intergenic
1005372729 6:25152729-25152751 GGGCCCTTGACCCTGTGCCCAGG - Intergenic
1005965852 6:30726148-30726170 TGGCCTTGGCCACCCAGCCCAGG + Intergenic
1006037557 6:31225404-31225426 GACCCCTGGCCACTGTGTCCTGG + Intergenic
1006272669 6:32976254-32976276 GGGCACTGGTAACACTGCCCTGG - Exonic
1006301100 6:33193832-33193854 GGGCCCTGTCCTCACAGCCCAGG + Exonic
1006981909 6:38154107-38154129 CAGACCTGGCCCCTCTGCCCTGG - Exonic
1012028915 6:94033045-94033067 AGGCCCTGGCAATTCTTCCCAGG - Intergenic
1015803430 6:137084247-137084269 GGGTCCTGCCCAGGCTGCCCTGG + Intergenic
1015862740 6:137697705-137697727 TGGCCCTGTCCATCCTGCCCAGG + Intergenic
1016199978 6:141395009-141395031 GGGACCTGCCCCTTCTGCCCAGG - Intergenic
1016898377 6:149076153-149076175 GGGCCCTGGTCTCTCTGAACAGG - Exonic
1018230813 6:161673491-161673513 GGTGCCTGGCCAATGTGCCCTGG - Intronic
1018550837 6:164997054-164997076 CTGCCCTGGCCCCTCAGCCCCGG + Intergenic
1018673157 6:166195992-166196014 GGGCCCTGGCAACTCCCCACTGG + Intergenic
1018762429 6:166903840-166903862 GTGCCCTGGCACCTCTGACCTGG + Intronic
1019493628 7:1326248-1326270 AGGCCCAGGCCACACAGCCCTGG - Intergenic
1019606792 7:1913999-1914021 GAGACCTGCCCACGCTGCCCTGG - Intronic
1019661028 7:2224126-2224148 GGGCCCACCCGACTCTGCCCAGG - Intronic
1019693693 7:2432630-2432652 GGGCCTTGGTCATCCTGCCCCGG - Exonic
1019773655 7:2899334-2899356 GGTCCCTGACCACTCTTTCCAGG + Intergenic
1020254918 7:6497678-6497700 GGTCCGGGGCCACTGTGCCCCGG - Intronic
1022263242 7:28727775-28727797 GGGCTCTGACCACTCTGCCCAGG + Intronic
1022375326 7:29806761-29806783 CGGGCCGGGCCACTCTGCTCCGG - Intronic
1023802377 7:43846194-43846216 GGGCTCTGGCAACTGTGCTCTGG + Intergenic
1023828816 7:44027853-44027875 AAGCCCTGCCCACCCTGCCCCGG + Intergenic
1023863494 7:44228395-44228417 GGGCCCTGCCCATGGTGCCCAGG - Intronic
1024313396 7:47991106-47991128 GGGGTCTGGCCATGCTGCCCAGG + Intronic
1024611077 7:51064875-51064897 GGGCCCTGGAGACTGTGCTCAGG - Intronic
1024963827 7:55004680-55004702 GGCGCCTGGCCAGCCTGCCCGGG - Intergenic
1026795559 7:73364054-73364076 GGACCCAGCCCACTATGCCCCGG - Intergenic
1026848678 7:73711706-73711728 GTGTCCTGCCCTCTCTGCCCTGG + Intronic
1026914607 7:74112322-74112344 AGCCCATGGCCACTCTGCCATGG - Intronic
1026950739 7:74344888-74344910 GGGCCCTGGTGTCTCTGCCATGG - Intronic
1027190747 7:75994357-75994379 GGGCCCTGGCGTCACTGCCAAGG - Intronic
1027589230 7:80096852-80096874 GGACCCTGGCCACAGTACCCTGG + Intergenic
1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG + Intronic
1029739115 7:102482110-102482132 AAGCCCTGCCCACCCTGCCCCGG + Intergenic
1029757116 7:102581289-102581311 AAGCCCTGCCCACCCTGCCCCGG + Exonic
1032802367 7:135327217-135327239 GGGCCCTGGGCTCTGTGTCCTGG - Intergenic
1034962437 7:155371424-155371446 CGGCCCTGGCCCCTCTGCAAGGG + Intergenic
1035075469 7:156174708-156174730 GGGCCTTCGCCACGCTGTCCTGG + Intergenic
1035434583 7:158849973-158849995 GGGGCCTGGCCCTTTTGCCCAGG + Intergenic
1035495550 7:159322519-159322541 AGGCCCTGGCCAGTCTGTCCAGG + Intergenic
1036570244 8:9974071-9974093 GTGCCCAGGCCACTCTGCCCAGG - Intergenic
1036750341 8:11439867-11439889 GGGCCCTGGGCACTCAGCACAGG - Intronic
1037450853 8:19014235-19014257 GGGTCCCGGCCTCTCTGACCGGG + Intronic
1039056351 8:33540223-33540245 GAACCCTGGCCACAGTGCCCTGG - Intergenic
1039454287 8:37697273-37697295 GGACCCCGGCCGCTCAGCCCCGG + Exonic
1039694487 8:39896241-39896263 GGGCCTTTGCCATGCTGCCCAGG - Intergenic
1041688863 8:60669981-60670003 GGTCCCTGGAGACTCTACCCTGG + Intergenic
1042696184 8:71557004-71557026 CCGCCATGGCTACTCTGCCCTGG - Intronic
1042733262 8:71960733-71960755 GGCTCATGGCCACGCTGCCCGGG - Intronic
1043813534 8:84773087-84773109 GGGCACAGGTCACTATGCCCAGG - Intronic
1044821106 8:96156507-96156529 GGGCCCTGGACCCCCAGCCCTGG - Intronic
1044987001 8:97764618-97764640 GGGACCTGGGCACTGTGACCTGG + Intergenic
1045264094 8:100604409-100604431 CGGCACTGGCCACTCGGCTCTGG + Intronic
1045320802 8:101080346-101080368 GTCCCCTGACCTCTCTGCCCTGG - Intergenic
1045653664 8:104365876-104365898 GCACCCTGACCACTGTGCCCAGG + Intronic
1047312749 8:123706360-123706382 GGGCCTTGGCCTCTCAGGCCTGG + Intronic
1048318911 8:133383447-133383469 GGGCCATGGGCTGTCTGCCCAGG - Intergenic
1048344364 8:133565820-133565842 TGGCCCTGGCCCATCTGCTCCGG - Intronic
1049229114 8:141473004-141473026 AGGCCCCGCCCACTCGGCCCAGG + Intergenic
1049255902 8:141613622-141613644 GGGCCCAGGCCCCCCAGCCCTGG - Intergenic
1049383835 8:142331053-142331075 GGGCTCTGCTCACCCTGCCCGGG - Intronic
1049531937 8:143159409-143159431 GGCCCTCGGCCCCTCTGCCCCGG - Intronic
1049574838 8:143385225-143385247 GGGTCCTGTCCCATCTGCCCAGG + Intergenic
1049647447 8:143741977-143741999 GCCCCCATGCCACTCTGCCCCGG + Intergenic
1049654328 8:143791176-143791198 GGGCCCAGGCCACGGCGCCCAGG + Exonic
1049800885 8:144517102-144517124 GAGCCCTGGCGGCTCCGCCCTGG + Exonic
1051843204 9:21421748-21421770 GTGCACTGGCCACTCTATCCCGG - Intronic
1053004129 9:34593180-34593202 GGGCCCCGGCCAAGCCGCCCCGG - Intergenic
1053643363 9:40107832-40107854 CGTCACTGTCCACTCTGCCCAGG - Intergenic
1053762789 9:41357658-41357680 CGTCACTGTCCACTCTGCCCAGG + Intergenic
1053801379 9:41766429-41766451 AGGCCCGGTGCACTCTGCCCAGG + Intergenic
1054143821 9:61548394-61548416 AGGCCCGGTGCACTCTGCCCAGG - Intergenic
1054189810 9:61978583-61978605 AGGCCCGGTGCACTCTGCCCAGG + Intergenic
1054463597 9:65479733-65479755 AGGCCCAGTGCACTCTGCCCAGG - Intergenic
1054541391 9:66268771-66268793 CGTCACTGTCCACTCTGCCCAGG + Intergenic
1054648704 9:67610009-67610031 AGGCCCGGTGCACTCTGCCCAGG - Intergenic
1056383873 9:86079535-86079557 GGGAACTGGCCACACTGCCCTGG - Intronic
1056643167 9:88388263-88388285 GGGGCCTGGCCCCTCTCACCTGG - Intergenic
1057131748 9:92658815-92658837 CAGCCCTGGCCTCCCTGCCCTGG - Intronic
1057279943 9:93702022-93702044 GGGCCCTGGCCACTCCGGGCTGG - Intergenic
1057514569 9:95710601-95710623 GGGCCCAGGCAGCTCTGCTCTGG + Intergenic
1057794690 9:98146741-98146763 GGGTCCTGGACACACTGCACAGG + Intronic
1060824851 9:126682117-126682139 GGGCTTTGGCCATTTTGCCCAGG + Intronic
1060831362 9:126719743-126719765 GGGGCCTGCCCACTCTGGGCTGG - Intergenic
1061045736 9:128163869-128163891 GGGCGCTCCCCACTCTGCCCAGG + Exonic
1061678325 9:132230607-132230629 GGGCCCTGGCCACCCTCCCCAGG - Intronic
1061700329 9:132410543-132410565 GCGCCCTGGCCCCGCGGCCCGGG + Intronic
1061801276 9:133114594-133114616 GGCCCCAGGGCACTCTGGCCGGG + Intronic
1061926073 9:133806663-133806685 GAGCTCTGGTCACGCTGCCCTGG - Intronic
1062077731 9:134601016-134601038 AGGGCCTGGGGACTCTGCCCTGG - Intergenic
1062079972 9:134618671-134618693 GGGCCCTGGCCGCTTTGCTGAGG + Intergenic
1062232459 9:135489456-135489478 GGGCCCTGTGCATTCTGTCCTGG - Intergenic
1062285173 9:135769639-135769661 GGGCCCTGACCCCTGTCCCCTGG - Intronic
1062285184 9:135769673-135769695 AGGCCCTGGCCCCTGTGCCTTGG - Intronic
1062461053 9:136662734-136662756 GGGGCCTGGACAAACTGCCCAGG - Intronic
1062644563 9:137540799-137540821 GGCCCGTGGCCCCACTGCCCTGG - Intronic
1203775873 EBV:72967-72989 GGGCCCTGGACACTGGACCCAGG + Intergenic
1186691744 X:11985229-11985251 GGGGCCTCACAACTCTGCCCTGG - Intergenic
1189292195 X:39894480-39894502 GGTGCCTGGCCACTTTGCTCAGG - Intergenic
1189377351 X:40475996-40476018 TGGCCCTGGCCTCTCTGAGCAGG + Intergenic
1191846577 X:65551623-65551645 CGGCCCTGGCCCCACGGCCCCGG + Intergenic
1191884267 X:65873407-65873429 GGGCTCAGGCGTCTCTGCCCAGG + Intergenic
1192585991 X:72318575-72318597 GGGTCCTGTCCCCTCTGCTCAGG + Intergenic
1192926237 X:75758216-75758238 GGCCCCTGGCCCCTCTCCACAGG - Intergenic
1193856771 X:86612171-86612193 GGGGCCTTGCCACTCTGTCTGGG + Intronic
1197810891 X:130442004-130442026 AGGGCCTGGCAACTCTGACCAGG + Intergenic
1199134693 X:144236037-144236059 GGCCCCTGAGCACTCTTCCCAGG - Intergenic
1199978621 X:152908769-152908791 TGGCCCTGGCCACACTCCCAGGG - Intergenic
1200215031 X:154364429-154364451 TGTCCCTGGCCACCCTGCCTGGG - Intronic
1200222891 X:154400500-154400522 GAACCCTGGCCACAGTGCCCTGG - Exonic