ID: 1029226920

View in Genome Browser
Species Human (GRCh38)
Location 7:99035046-99035068
Sequence CACTGAGGTCGCCGGAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029226920_1029226930 23 Left 1029226920 7:99035046-99035068 CCCCACTTCCGGCGACCTCAGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1029226930 7:99035092-99035114 TCATCTTTCGGTGTGGTTGGTGG No data
1029226920_1029226926 -3 Left 1029226920 7:99035046-99035068 CCCCACTTCCGGCGACCTCAGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1029226926 7:99035066-99035088 GTGGCTTAAACAGAGTGAGCAGG No data
1029226920_1029226927 11 Left 1029226920 7:99035046-99035068 CCCCACTTCCGGCGACCTCAGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1029226927 7:99035080-99035102 GTGAGCAGGACATCATCTTTCGG 0: 1
1: 0
2: 0
3: 34
4: 642
1029226920_1029226929 20 Left 1029226920 7:99035046-99035068 CCCCACTTCCGGCGACCTCAGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1029226929 7:99035089-99035111 ACATCATCTTTCGGTGTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 71
1029226920_1029226928 16 Left 1029226920 7:99035046-99035068 CCCCACTTCCGGCGACCTCAGTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1029226928 7:99035085-99035107 CAGGACATCATCTTTCGGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029226920 Original CRISPR CACTGAGGTCGCCGGAAGTG GGG (reversed) Intronic
900538107 1:3188908-3188930 AACTGAGGTGGCTGGAGGTGGGG - Intronic
900760864 1:4469296-4469318 GCCAGAGGGCGCCGGAAGTGGGG + Intergenic
900939097 1:5786459-5786481 TACTGGGGTCGTGGGAAGTGGGG - Intergenic
909322399 1:74306019-74306041 CACTGAGGTTTCCAAAAGTGAGG - Intronic
909861985 1:80618535-80618557 CACTGAGGACTCTGAAAGTGAGG + Intergenic
909863548 1:80637583-80637605 TACCAAGGTCGCCGGAACTGGGG + Intergenic
910109014 1:83661939-83661961 CAGTGAGGAAGGCGGAAGTGAGG - Intergenic
911046865 1:93635980-93636002 CACTGAGGTCTCCGGCAGCCAGG + Intronic
915558273 1:156672136-156672158 CACTGAGATCTCCAGAAGTAGGG - Exonic
922586066 1:226736171-226736193 CCCTGAGGAGGCCCGAAGTGGGG - Exonic
1064768304 10:18697291-18697313 CACTGAGGTTGCCTGAGGTGAGG - Intergenic
1068044461 10:51868319-51868341 CACTGAGATGGCTGGAGGTGGGG + Intronic
1083922721 11:65789211-65789233 CACTGTGGCCACTGGAAGTGTGG - Intronic
1084225469 11:67712213-67712235 CACTGAGGTCGCCAGGGGCGTGG - Intergenic
1084263292 11:67992063-67992085 CACTGAGGTCGCCAGGGGCGTGG - Intronic
1098794247 12:74867921-74867943 CACTGAGGACTCCAAAAGTGGGG - Intergenic
1101493433 12:105231576-105231598 CACTGAGGTCACCAGCAGGGTGG + Intronic
1101716584 12:107318233-107318255 CACCGAGGCTGCAGGAAGTGGGG - Intergenic
1103325956 12:120120835-120120857 CACAGAGGTGGCAGGAAGTTTGG + Intergenic
1111683143 13:91468549-91468571 GCCTGAGGTTACCGGAAGTGAGG + Intronic
1116283328 14:42939114-42939136 CTCTGAGGACTCCAGAAGTGTGG + Intergenic
1117864172 14:60128226-60128248 CACTGAAGTTCCCGGATGTGTGG - Intronic
1130305816 15:82711500-82711522 CCCTGAGGTCTCAGGAAATGGGG - Intergenic
1133830777 16:9321552-9321574 CACTGAGGTCAGCTGCAGTGGGG - Intergenic
1134366812 16:13586452-13586474 CACTGAGGACTCCAAAAGTGGGG - Intergenic
1141340885 16:83202881-83202903 CACTGAAGACTCCAGAAGTGGGG + Intronic
1141689180 16:85586833-85586855 CACTGAGCTCGCCTGAGCTGGGG - Intergenic
1142166696 16:88594463-88594485 CACAGAGGTGGCAGGAACTGAGG - Intronic
1145407269 17:22614743-22614765 CACTGGGGTCTCTGGGAGTGTGG + Intergenic
1151987056 17:77550240-77550262 CACTGAGATGGCAGGAACTGAGG - Intergenic
1152542888 17:80985551-80985573 CACCTTGGTCTCCGGAAGTGCGG - Intergenic
1161470902 19:4456393-4456415 CAGGGAGGTGGCAGGAAGTGGGG - Intronic
1167430557 19:49451860-49451882 CACTGGGGTACTCGGAAGTGTGG - Intronic
925745947 2:7043761-7043783 CACTGAAGGCTCCGGAACTGTGG - Exonic
927249240 2:20983040-20983062 CACTGAGGCCATCTGAAGTGTGG + Intergenic
932087251 2:68773485-68773507 CACTGAGGACTCCAAAAGTGGGG + Intronic
932608136 2:73177739-73177761 CACTGAGGTCCCCTGAAAAGTGG - Intergenic
943657958 2:190529280-190529302 CACTCAGGTCCCTGGAAGGGAGG - Intronic
947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG + Intronic
1173657384 20:44709745-44709767 CACTGAGGTCCAGAGAAGTGAGG + Intergenic
1174387294 20:50194699-50194721 CATTGAGGTCCACAGAAGTGAGG + Intergenic
1174396652 20:50250948-50250970 CACTGAGGCCCAGGGAAGTGCGG - Intergenic
1180047848 21:45318091-45318113 CTCTGAGCTGGCCTGAAGTGGGG - Intergenic
1180222346 21:46367091-46367113 CACAGAGCTCGCCGGAACCGTGG + Exonic
1181594487 22:23905535-23905557 TACTGAGGTAGCAGGAAGAGAGG + Intergenic
1185250742 22:49800309-49800331 CGCTGATGTCCCCTGAAGTGAGG + Intronic
954462913 3:50637928-50637950 CCCAGAGGTGGCAGGAAGTGAGG + Intronic
964442880 3:156729934-156729956 CACTGAAGTCTCAGGAAGTCTGG - Intergenic
964683247 3:159365748-159365770 CACTGAGGTCACTAGAGGTGAGG - Intronic
970386678 4:15563501-15563523 CAGTGAGGAAGCCGGCAGTGAGG + Exonic
972154709 4:36145511-36145533 CACTGAGGACTCCAAAAGTGGGG + Intronic
973018162 4:45167311-45167333 CACTGAGGCCGTGGGGAGTGTGG - Intergenic
975626510 4:76354701-76354723 AACTGAGGTCGCCGGTAGGTGGG - Intronic
975724883 4:77282163-77282185 CAATGAGGTCTCCGGAGATGCGG + Intronic
976440607 4:85069231-85069253 CACTGGGGACTCCAGAAGTGGGG - Intergenic
976725414 4:88211369-88211391 CACTGGGGTCTCCAAAAGTGGGG - Intronic
977020469 4:91752816-91752838 CAGTGAGGTTGCAGGGAGTGGGG + Intergenic
980226475 4:129993411-129993433 TAGTAAGGTCTCCGGAAGTGGGG - Intergenic
980870995 4:138610498-138610520 CACAGAGGGAGCCCGAAGTGAGG - Intergenic
985118548 4:186616336-186616358 CACTGAGTTTGCCAGAAGTGGGG - Intronic
994598331 5:101868226-101868248 CACTGAGGTCCTCTGAAGGGTGG + Intergenic
998510938 5:142713436-142713458 TACTGAGGCCGCCGGCAGTCAGG - Intergenic
999518509 5:152324968-152324990 CACTGGGGACTCCAGAAGTGGGG - Intergenic
1001873913 5:175182779-175182801 AACTGAGGTCCCCAGAAGTGGGG - Intergenic
1005995891 6:30931301-30931323 CACAGAGCTGGCAGGAAGTGGGG - Intergenic
1008927487 6:56902431-56902453 CACTGAGGGAGCCGGAAGATGGG + Intronic
1009433779 6:63595147-63595169 CACTGAGGACTCCAGAAGAGGGG + Intergenic
1011625827 6:89282725-89282747 CACAGAGGCAGCCCGAAGTGGGG + Intronic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1018442632 6:163826955-163826977 CACGGAGGTCCCAGGAAGAGCGG + Intergenic
1022181054 7:27920722-27920744 CTCTGTTGTCGGCGGAAGTGGGG - Intronic
1024221480 7:47291564-47291586 CACTGGGGTTGCTGGCAGTGTGG + Intronic
1029226920 7:99035046-99035068 CACTGAGGTCGCCGGAAGTGGGG - Intronic
1029888915 7:103905856-103905878 CACGGAGGTAGCGGGAAGGGAGG + Intronic
1035386208 7:158474773-158474795 CACTGAGGGAGTCGGGAGTGGGG + Intronic
1036571869 8:9986807-9986829 CCCTGAAGTGGCAGGAAGTGGGG - Intergenic
1038674849 8:29614506-29614528 CACTGAGGTCCAAGGGAGTGAGG - Intergenic
1039125687 8:34198749-34198771 TACTGATGTCGTGGGAAGTGGGG + Intergenic
1049033388 8:140054156-140054178 CACTGAGGACTCCAAAAGTGGGG + Intronic
1049563332 8:143324419-143324441 CCCTGAGGACGCCGGCAGGGAGG - Intronic
1056190010 9:84175824-84175846 CACTGAGGTAGACGGCAGTTTGG + Intergenic
1058254492 9:102743959-102743981 CACAGAGGTGGCCTGAAATGGGG - Intergenic
1061949766 9:133929762-133929784 CACTGGGGTCGCTGGTGGTGGGG - Intronic
1062170372 9:135131685-135131707 CGCTGAGCTGGCCGGAAGTGTGG - Intergenic
1203444662 Un_GL000219v1:44366-44388 CACTTAGGCCGACTGAAGTGTGG - Intergenic
1187321717 X:18245285-18245307 CACTAAGGTAGCCGGTATTGGGG - Intronic
1187526142 X:20056843-20056865 CACTGAGGCAGCAGGTAGTGTGG - Intronic
1189267258 X:39726296-39726318 CACTGAGGTCGGAGGAAGGAAGG - Intergenic
1197753239 X:129979894-129979916 CACTGAGGTCGCCCAGGGTGGGG + Intergenic
1197788951 X:130231554-130231576 CACTGAGGTCTCCAAAAGTTGGG + Intronic
1198633157 X:138664985-138665007 CAATGAGCTCTCTGGAAGTGAGG + Intronic