ID: 1029227531

View in Genome Browser
Species Human (GRCh38)
Location 7:99038891-99038913
Sequence TGCCAAGAAAATACTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029227527_1029227531 14 Left 1029227527 7:99038854-99038876 CCAGGGTCAAAGGGAAATTGACC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1029227531 7:99038891-99038913 TGCCAAGAAAATACTGTGCCTGG No data
1029227529_1029227531 -7 Left 1029227529 7:99038875-99038897 CCTGGAGATGAAGCCATGCCAAG 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1029227531 7:99038891-99038913 TGCCAAGAAAATACTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029227531 Original CRISPR TGCCAAGAAAATACTGTGCC TGG Intronic
No off target data available for this crispr