ID: 1029234180

View in Genome Browser
Species Human (GRCh38)
Location 7:99099584-99099606
Sequence TTTGATCCCCACTGTGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 2, 2: 2, 3: 39, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029234174_1029234180 22 Left 1029234174 7:99099539-99099561 CCACTGCTGTGGTTTGGTCTGTC 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG 0: 1
1: 2
2: 2
3: 39
4: 209
1029234175_1029234180 0 Left 1029234175 7:99099561-99099583 CCCCACCAAAACTCATGTTAAAA 0: 4
1: 118
2: 644
3: 2340
4: 3933
Right 1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG 0: 1
1: 2
2: 2
3: 39
4: 209
1029234178_1029234180 -5 Left 1029234178 7:99099566-99099588 CCAAAACTCATGTTAAAATTTGA 0: 9
1: 182
2: 983
3: 2536
4: 4308
Right 1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG 0: 1
1: 2
2: 2
3: 39
4: 209
1029234176_1029234180 -1 Left 1029234176 7:99099562-99099584 CCCACCAAAACTCATGTTAAAAT 0: 7
1: 117
2: 709
3: 2946
4: 7030
Right 1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG 0: 1
1: 2
2: 2
3: 39
4: 209
1029234177_1029234180 -2 Left 1029234177 7:99099563-99099585 CCACCAAAACTCATGTTAAAATT 0: 33
1: 338
2: 1260
3: 2778
4: 3632
Right 1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG 0: 1
1: 2
2: 2
3: 39
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029234180 Original CRISPR TTTGATCCCCACTGTGGCAG CGG Intronic
901897648 1:12328320-12328342 TTTGGTCCCCACTCTAGCAAAGG - Intronic
902985347 1:20151249-20151271 TTTCCTCCCCACTGTCTCAGTGG - Intergenic
903181408 1:21606786-21606808 TTTCATGCCAACTGAGGCAGGGG + Intronic
904301891 1:29559576-29559598 TTTCAGCATCACTGTGGCAGGGG - Intergenic
904481552 1:30797201-30797223 TTTGCTGTCCACTGTGGCGGGGG - Intergenic
904862277 1:33547630-33547652 TCTGTTTCCCACTGTGGAAGAGG + Intronic
906518802 1:46455510-46455532 TTGGATCTCCCCTCTGGCAGTGG + Intergenic
907510642 1:54955787-54955809 TTTACTCCACAGTGTGGCAGTGG - Intergenic
907626408 1:56034839-56034861 GCTGGTCACCACTGTGGCAGAGG + Intergenic
910099661 1:83562724-83562746 TCTGATTCCCACTGTAGCTGCGG + Intergenic
911045790 1:93626416-93626438 TTTGAGCACCACTGTACCAGAGG - Intronic
911143262 1:94528441-94528463 TTTGCTTCCCACTGTGGAAGGGG - Intergenic
911889291 1:103346450-103346472 TTTTATCCTCCCTGGGGCAGGGG + Intergenic
912501380 1:110124571-110124593 TTTGATCCCCAGTGTTGGAGGGG + Intergenic
916059940 1:161091490-161091512 TTTGAGATCCTCTGTGGCAGGGG + Intergenic
916080231 1:161227635-161227657 GGTGTTCCCCACTGTGGTAGGGG + Exonic
916329666 1:163600431-163600453 TTTGGATCCCACTGTGACAGGGG + Intergenic
916937905 1:169649088-169649110 TTTGATCCCCATTGTGGTGGTGG - Intergenic
918061411 1:181064551-181064573 TTTAATCCCCACTTTGACACTGG - Intergenic
918108079 1:181430316-181430338 TCGGGTCCCCTCTGTGGCAGAGG - Intronic
918260051 1:182787488-182787510 TTTGAAACCCACTGGTGCAGGGG - Intergenic
918857897 1:189782032-189782054 TTTTACCCCCAGTCTGGCAGTGG - Intergenic
923756829 1:236798844-236798866 GTAGATCCCCACTCTGCCAGGGG + Intronic
924340202 1:243022266-243022288 TGTGATCCCCATTGTTGGAGGGG + Intergenic
1063122247 10:3113297-3113319 TTTGCTGCACACTTTGGCAGTGG - Intronic
1065291401 10:24233405-24233427 TTTGATCCCCAAAGTTGAAGGGG - Intronic
1065343337 10:24725014-24725036 TTTTATCCTCACTGCGGCCGGGG + Intergenic
1065529934 10:26658720-26658742 CTTGGTCCCCAAGGTGGCAGTGG - Intergenic
1065531983 10:26680095-26680117 AATTATCCCCACTGTGGCTGGGG - Intergenic
1065619523 10:27566185-27566207 CTTGATCCCCAATGTGGAGGTGG - Intergenic
1065648936 10:27866855-27866877 TTTGATCCCCAGTGTTGGAGTGG - Intronic
1066101214 10:32120356-32120378 TTTGATCCCAACTTTAACAGGGG - Intergenic
1066313312 10:34219234-34219256 TGATATCCCAACTGTGGCAGAGG + Intronic
1066736301 10:38483338-38483360 TGTGATCCCCATTGTTGGAGGGG - Intergenic
1067140706 10:43653997-43654019 TTTGATCCCCATGTTGGAAGTGG - Intergenic
1069001438 10:63271255-63271277 TTGAATCCCCACGGGGGCAGAGG - Intronic
1069738641 10:70673602-70673624 TTTCATCCCCATTATAGCAGAGG - Intronic
1069773315 10:70912840-70912862 TTTGAGCCGCAGTGTGGCTGGGG + Intergenic
1070918972 10:80172167-80172189 TTTGGTCCCCACTGTGGGAAAGG - Intronic
1071899008 10:90098424-90098446 TTTGTTCCCCAATCTGCCAGCGG + Intergenic
1072265633 10:93724484-93724506 TTTCATTCCCACTGTAGCATTGG - Intergenic
1073403271 10:103276215-103276237 TGGGATGCCCACAGTGGCAGAGG - Intergenic
1075653148 10:124143220-124143242 CCTGAGCCCCACTGTGGGAGTGG - Intergenic
1076505196 10:130967931-130967953 TTTGATCCCCAGTGTTGGAGAGG + Intergenic
1076622032 10:131795730-131795752 TTGGATCCCCAATGTGTCATGGG - Intergenic
1078687857 11:13549706-13549728 TTTGTCCCCCACAGTGGCTGTGG - Intergenic
1079381339 11:19940584-19940606 TTTTAACCCGACTGTGGAAGTGG - Intronic
1080519996 11:33060446-33060468 TTTGCTCTTCACTGGGGCAGGGG - Intronic
1082135005 11:48538171-48538193 TCTTTTCACCACTGTGGCAGAGG + Intergenic
1082156814 11:48831117-48831139 TTTGATGCCTACTGTGGAAAAGG + Intergenic
1082157133 11:48836692-48836714 TTTGATGCCTACTGTGGAAAAGG + Intergenic
1084692850 11:70737046-70737068 TTTTATCCCCACTTTGGCCGCGG - Intronic
1086234308 11:84609600-84609622 TTTCATCCCATCTATGGCAGAGG - Intronic
1093457936 12:19382913-19382935 TTTAATTCTCAATGTGGCAGGGG - Intergenic
1093816352 12:23553348-23553370 TTTTTTCCTCCCTGTGGCAGCGG - Intronic
1094030570 12:26007246-26007268 TTTGATCCCCAGTGTGGCAGTGG - Intronic
1095058166 12:37643748-37643770 TTTGATGCCTACTGTGGAAAAGG - Intergenic
1096813898 12:54189365-54189387 TCTTATACCCACGGTGGCAGGGG - Intergenic
1098707826 12:73713568-73713590 TTTGATCCTGACAGTGGAAGGGG - Intergenic
1098827768 12:75319258-75319280 TTTAATCCCCAATGTTGGAGTGG + Intronic
1099209607 12:79767939-79767961 TTTGAAAACCACTGTTGCAGAGG + Intergenic
1099347786 12:81524379-81524401 CTTGAGGCCCACTGGGGCAGAGG - Intronic
1100602837 12:96126756-96126778 TGTAATCCCCACTGTTGCTGGGG - Intergenic
1102387366 12:112520915-112520937 TTTAATCCTCACAGTGGCATGGG - Intergenic
1102484902 12:113248941-113248963 TTTGGGCCACAGTGTGGCAGGGG + Intronic
1102577448 12:113864890-113864912 ATTGAAACCCACTGTGGGAGTGG - Intronic
1103493610 12:121343728-121343750 TGTAATCCCCAGGGTGGCAGGGG - Intronic
1104128702 12:125872357-125872379 TCTGACCCCCAGTGTGTCAGGGG + Intergenic
1105427015 13:20302578-20302600 TTTTAACACCACTGTGGCACAGG + Intergenic
1105833056 13:24182649-24182671 TGTGATCCCCAGTGTTGAAGCGG - Intronic
1108452120 13:50577232-50577254 CTTGAACCCCAGTGGGGCAGAGG - Intronic
1110797488 13:79657173-79657195 TTTGATTCCCAGTGTTGGAGTGG + Intergenic
1112883637 13:104140660-104140682 TTTGAACCCCACTGTGACTTTGG + Intergenic
1114077892 14:19172862-19172884 TTTGATCCCCAGTGTCAGAGGGG + Intergenic
1114598575 14:23935151-23935173 TGTGATCCCCAGTGTGGAGGTGG - Intergenic
1115272709 14:31571978-31572000 TGTGATCCCCACTGTAGTTGAGG + Intronic
1115314467 14:32011574-32011596 TTTGAAGTCCACTGTGCCAGAGG - Intronic
1116322731 14:43491802-43491824 GTTTATCCCCACTGTGTCATTGG - Intergenic
1118382044 14:65225375-65225397 TTGTAGCCCCACTGTGGCTGTGG + Intergenic
1120957715 14:90097522-90097544 TTTGATCCCCAATGTGGTGGTGG - Intronic
1121215443 14:92244170-92244192 TTTGATCCTCAGTGTTGGAGTGG - Intergenic
1122454759 14:101841759-101841781 TTTGAGGCCAACTGGGGCAGTGG + Intronic
1122866522 14:104607455-104607477 CTTAATCCCCAATGTGACAGTGG + Intergenic
1123898209 15:24849443-24849465 TGTGATCACCACTGTGGCACTGG - Intronic
1124368555 15:29090581-29090603 TTATGTCCCCTCTGTGGCAGGGG - Intronic
1126457718 15:48882336-48882358 TTTGGTCCCCACTCTAGCAGTGG + Intronic
1126548058 15:49894681-49894703 CCTGATCACCACTGTGGCAAAGG - Intronic
1128182115 15:65613264-65613286 TTTGATCCCCAGTCTGACAGAGG + Intronic
1129743407 15:78001219-78001241 TTTGATCCATGCTGTGGTAGAGG - Intronic
1129965481 15:79731349-79731371 TTTCATCCCCGCTTTGGCAGGGG - Intergenic
1130545939 15:84857726-84857748 TCTGACACCCACTGTGGAAGTGG + Exonic
1132437333 15:101819290-101819312 TTTGATGCACACTGTGCCAAAGG - Intergenic
1135463635 16:22666143-22666165 TGTGATCCCCAGTGTTGGAGTGG - Intergenic
1136053905 16:27673655-27673677 TTTGATCACAACTGGGGGAGAGG - Intronic
1137265226 16:46863277-46863299 TTTGATCCCCAGCCGGGCAGTGG - Intergenic
1143317337 17:6042399-6042421 TGTGATCCCCAGTGTTGGAGGGG - Intronic
1145029140 17:19491277-19491299 TGTTATCCCCACAGTGGCTGAGG + Intergenic
1146723376 17:35138800-35138822 TTTGAAAACCACTGTGGCAGAGG + Intronic
1146759481 17:35464152-35464174 TTTGATCCTCAGTGTTGGAGAGG - Intergenic
1147889781 17:43709245-43709267 TTTAATCCTCACTGTGGCTGGGG - Intergenic
1149674402 17:58446571-58446593 GTTTCTTCCCACTGTGGCAGTGG - Intronic
1150642562 17:66959360-66959382 TTTTATCCCCATTGTGTAAGTGG - Intergenic
1203159883 17_GL000205v2_random:39316-39338 TTTAACCCCCCCTGGGGCAGGGG + Intergenic
1155281956 18:24249643-24249665 TTTGCTCGCCACTATGACAGGGG - Intronic
1156116675 18:33794309-33794331 TTTGATCCCCAGTGTTGGGGTGG + Intergenic
1156654878 18:39273154-39273176 TTTGATCTCCATCGTGGCAGTGG + Intergenic
1157751603 18:50183721-50183743 TTTGATCCCCAATGTGGCGGGGG + Intronic
1158328650 18:56337642-56337664 TTTGATCCCCAGTGTGGTGTTGG + Intergenic
1158387486 18:57012199-57012221 CTTCATCCTCACTGTGACAGTGG + Intronic
1158530349 18:58255414-58255436 TCTCATCCACACTGTGACAGAGG - Intronic
1160376221 18:78414645-78414667 TGGGGTCCACACTGTGGCAGAGG - Intergenic
1161177480 19:2854742-2854764 CTTGATTTCCACTGTGTCAGAGG + Exonic
1164942718 19:32264053-32264075 GTGGATCCCCAGCGTGGCAGAGG - Intergenic
1165167308 19:33865879-33865901 TGTGATCCCCAGTGTTGGAGTGG - Intergenic
1165481219 19:36065662-36065684 TAGGATACCCACTGCGGCAGAGG + Intronic
1166322485 19:42027272-42027294 TCTGCTCCCCACTGTTGCAAGGG + Intronic
1166399462 19:42467612-42467634 TTTGATCGCTTCTGTGACAGAGG + Intergenic
1166913234 19:46176252-46176274 TTTGTTCCTCTCTGTGGAAGAGG - Intergenic
1166981336 19:46634032-46634054 TTGGATCCATACTTTGGCAGGGG + Intergenic
1167248860 19:48390380-48390402 TCTGGCCCCCACTGAGGCAGAGG - Intronic
925051612 2:819956-819978 TTTGACCCTCACTGGGGAAGGGG + Intergenic
925127745 2:1472633-1472655 GGTGATCCACGCTGTGGCAGAGG - Intronic
925469700 2:4146446-4146468 TTTTATCCCCACTTAGCCAGTGG + Intergenic
926351763 2:12001948-12001970 TTTCAGCCCCACTGGGCCAGTGG - Intergenic
926637688 2:15200497-15200519 TTTGACACTCACTGTGGAAGGGG - Intronic
928110854 2:28507545-28507567 CTTGATCCCCAATGTAGCAGTGG - Intronic
929828230 2:45327237-45327259 TGTGATCCCCAGTGTTGGAGGGG + Intergenic
930335099 2:50035705-50035727 TGTGATACCCACTGTGTCTGTGG - Intronic
932696883 2:73964530-73964552 TATGGTCCCCATTGTAGCAGTGG + Intergenic
933610488 2:84429483-84429505 ATTGGTGCCCACTGTGCCAGGGG + Intronic
935095454 2:99940288-99940310 TTTTATCCTCACAGTGTCAGAGG + Intronic
936629041 2:114180513-114180535 TTTGATCCCCAATGTGTCAGTGG + Intergenic
936735647 2:115439662-115439684 TGTGATCTCCTATGTGGCAGTGG + Intronic
939400516 2:141686699-141686721 CTTCATCCCCAATGTGGCAGAGG + Intronic
940128371 2:150353590-150353612 TTTGTTCCGTACTGTGGAAGTGG - Intergenic
943018629 2:182546032-182546054 CTTCATCCCCTCTGTGGCTGAGG + Intergenic
943309386 2:186307948-186307970 TTTGAACCCCACTGGGGCATGGG - Intergenic
1170339468 20:15307104-15307126 TGTGATCCCCAGTGTTGGAGTGG - Intronic
1171000075 20:21405659-21405681 TTTGATCCCCAGTGTTGGAGTGG + Intergenic
1173877684 20:46385468-46385490 TTTGATCCTCACAGTGTGAGAGG + Intronic
1174191637 20:48744708-48744730 TCTGATGGTCACTGTGGCAGAGG + Intronic
1174912860 20:54625297-54625319 TTGGACCCCCACTGTCCCAGGGG - Intronic
1175583390 20:60118076-60118098 TTTGATGGCAGCTGTGGCAGAGG + Intergenic
1175967309 20:62666037-62666059 TTGGCTTCCCACTGGGGCAGGGG + Intronic
1180156460 21:45979820-45979842 TGTCATCCACACTGTGGCTGTGG - Intergenic
1181365754 22:22375939-22375961 TTTTCTTCCCACTGTTGCAGAGG - Intergenic
1181476220 22:23169230-23169252 TTTGCTCCGCACTCTGGCTGGGG + Intergenic
1183091479 22:35525265-35525287 CAGGAGCCCCACTGTGGCAGAGG - Intergenic
1183479121 22:38053149-38053171 TTTGAGGACCACTGTGCCAGAGG - Intergenic
1183594285 22:38800785-38800807 TATAATCCCCAGTGTTGCAGGGG + Intergenic
1184872235 22:47248072-47248094 TTCGAACCCCACAGTGGGAGAGG + Intergenic
1203330929 22_KI270738v1_random:87875-87897 TTTGATGCCTACTGTGGAAAAGG - Intergenic
949338627 3:3004838-3004860 TTTCAGACCCACTGGGGCAGTGG + Intronic
949516290 3:4810214-4810236 TTTGGTCTCCACTGTGGCTTTGG - Intronic
949850141 3:8412717-8412739 TTTGACCCCAAGTGTGACAGGGG - Intergenic
950428936 3:12939900-12939922 CTTGAGCTCCACTGTGGCACAGG - Intronic
951229832 3:20165357-20165379 TCTGATCCCCAGTGTTGCTGGGG - Intronic
951232527 3:20195888-20195910 TTTTATCTCCACTGTGGTAGTGG + Intergenic
953647297 3:44767308-44767330 TTGGTTCTACACTGTGGCAGTGG + Intronic
954538486 3:51378759-51378781 TGTCATCCCAACTGTGGCTGAGG + Intronic
955176021 3:56613474-56613496 TTGGTTCCCCTCTGTGGAAGAGG + Intronic
956173237 3:66449618-66449640 TCTGAACCACACTGTGCCAGAGG - Intronic
957943885 3:87038035-87038057 TCTGGTCCCTACTGTGGAAGGGG - Intergenic
962593422 3:136914796-136914818 TTTGATCCCCATGTTGGAAGTGG + Intronic
962705131 3:138035977-138035999 TTAGCTACCCACTGTGGCAGGGG - Intergenic
963003954 3:140708516-140708538 TGTGTTCCCCACTGGGGAAGGGG - Intergenic
963931904 3:151012404-151012426 TTTGTTCTTCACTGGGGCAGGGG + Intergenic
966385466 3:179393055-179393077 TTTCTTCCCCACTGTGGAAGAGG + Exonic
968684364 4:1947050-1947072 TTTGCTCAGCACTGTGCCAGTGG + Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
970007244 4:11423614-11423636 TTTGTTCCCTACTGTGTCACCGG + Intronic
973650017 4:52989655-52989677 TATGTTTCCCACTGTGGCATTGG + Intronic
976741087 4:88358293-88358315 TTTGCACCCCACTGGGGCAGGGG - Intergenic
976838473 4:89403511-89403533 TTTGACCTCCACTGAGGCTGGGG - Intergenic
979262653 4:118666307-118666329 TGTGATCCCCATTGTTGGAGGGG - Intergenic
981875104 4:149532795-149532817 GTTGATTTCCAGTGTGGCAGGGG - Intergenic
982158223 4:152541229-152541251 CGTGCTCCCCACAGTGGCAGTGG + Intergenic
983851991 4:172592419-172592441 TTTGATCCCCAGTGTGGGGATGG - Intronic
986874952 5:12096284-12096306 TTTGATCCCCAGTTTAGAAGTGG - Intergenic
989252168 5:39330035-39330057 TTTGATGCCAACTGGGGCAGTGG - Intronic
989752770 5:44915782-44915804 TTTGATCCCCAATGTTGGAGGGG + Intergenic
991246473 5:64513657-64513679 TTTGATCCACACGGTGGAGGAGG + Intronic
992206883 5:74439628-74439650 GTTGAGCCCAAGTGTGGCAGGGG + Intergenic
992271160 5:75064035-75064057 CTTAATCCCCAATGTAGCAGTGG - Intergenic
992313623 5:75529421-75529443 TGTGATCCCCAATGTTGGAGTGG - Intronic
992647358 5:78823937-78823959 TGTGATCCCCAATGTTGGAGGGG + Intronic
992703380 5:79363018-79363040 TTGGAGCCCCAGTGTGGCATCGG - Intergenic
993979384 5:94526325-94526347 TTCCATCCCCACTGTGCCAGAGG - Intronic
995751602 5:115458230-115458252 TGTGATCCCCACTGCTGAAGGGG + Intergenic
996209084 5:120782554-120782576 TTTGGTCCCCACTGAGATAGAGG - Intergenic
996565479 5:124875691-124875713 TTTCTTCCCCACTGTGGAAGAGG - Intergenic
996727249 5:126683477-126683499 TTTGATCCCCAATATCGGAGTGG + Intergenic
997642940 5:135461616-135461638 ATAGATCCCCCCTGGGGCAGAGG - Intergenic
998326627 5:141286599-141286621 TTTGATCCCCAGTGTTGGAGGGG - Intergenic
998851839 5:146358544-146358566 TTTGATCCCCATTGTTGGAGGGG - Intergenic
1000237545 5:159376532-159376554 TCTGTTCCCCACAGTGGCTGAGG + Intergenic
1000278950 5:159765401-159765423 TTAGATCTCCACTGTGGCAAAGG + Intergenic
1001120304 5:168974817-168974839 TCTGATCCCAACTGCTGCAGGGG + Intronic
1001487098 5:172127574-172127596 TTTGAGGCCCACTGGGGGAGGGG - Intronic
1002515434 5:179754635-179754657 TTTGAGAACCACTGTGGTAGTGG - Intronic
1007182290 6:39938197-39938219 TTTGATCCCCAGTGTGGCAGTGG + Intergenic
1007610357 6:43145102-43145124 GTGGGTCCCCACTGTGGGAGAGG + Intronic
1009652958 6:66499738-66499760 TGTAATCCCCATTGTGGAAGTGG + Intergenic
1013137300 6:107295011-107295033 CTTGAACCCCAGTGGGGCAGAGG - Intronic
1014280526 6:119438077-119438099 TTTGATCCCGACTGTGCTACAGG + Intergenic
1018042303 6:159935584-159935606 TGGGATCCCCTCTGTGACAGTGG + Intergenic
1018766416 6:166936715-166936737 TTTGATCACCAGTGTGGAGGTGG - Intronic
1019742204 7:2680523-2680545 TGAGATCCCCTCTGTGGCTGGGG + Intronic
1020501355 7:8925344-8925366 CTTAATCCCCAATGTGGTAGAGG - Intergenic
1022183808 7:27947737-27947759 TTTGATCCACAGTGAGGAAGGGG - Intronic
1023192101 7:37593807-37593829 TGTGATCCCCAGTGTTGGAGGGG + Intergenic
1023337285 7:39183573-39183595 TATAATCCCCAATGTGGAAGAGG - Intronic
1025994081 7:66517299-66517321 TTTGGTGCCCACTCTGGCAGTGG - Intergenic
1026445916 7:70484587-70484609 ATTCATCCCCACAGTGGCACTGG - Intronic
1029234180 7:99099584-99099606 TTTGATCCCCACTGTGGCAGCGG + Intronic
1030777637 7:113553848-113553870 TGTGATCCCCAATGTTGCAGGGG - Intergenic
1032584304 7:133132231-133132253 TTTGAACACCTCTGTGGCAATGG + Intergenic
1037313692 8:17581504-17581526 TTTGATCCCCCATGTGGTGGTGG + Intronic
1038413042 8:27373180-27373202 TGGGCTCCCCACTGTGGCAGGGG - Intronic
1040011247 8:42662768-42662790 TCTGATCCCCAGTGTTGGAGGGG - Intergenic
1040516905 8:48143158-48143180 TTTTATCCCCGATGTGGCCGTGG - Intergenic
1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG + Intronic
1042293257 8:67192154-67192176 CTTGAACCCCACTGGGGCAGAGG - Intronic
1042606046 8:70547895-70547917 TTTGATCCCCAGTGTTGAGGAGG + Intergenic
1042954819 8:74238515-74238537 TCTGAGCTCCACAGTGGCAGGGG + Intronic
1045063203 8:98425801-98425823 TGTACTTCCCACTGTGGCAGTGG + Intronic
1045656201 8:104389567-104389589 TTTGATTCCCACTGTACCACTGG - Intronic
1046509996 8:115190258-115190280 GTTAATCACTACTGTGGCAGGGG + Intergenic
1048216403 8:132499590-132499612 TTTGATCAGCACTGTGCCAGGGG - Intergenic
1049550155 8:143253695-143253717 TGTGATCCCCAGTGTGGGAAGGG + Intronic
1049566695 8:143344029-143344051 TTAGAGCCCTACTGAGGCAGAGG + Intronic
1050069199 9:1792584-1792606 TTTCACCCCCATTGTGACAGCGG + Intergenic
1051026255 9:12615314-12615336 TGTGTTCCTCACTGTGGAAGTGG + Intergenic
1053230447 9:36403185-36403207 TTTGACACCTAATGTGGCAGGGG + Intronic
1055914063 9:81382327-81382349 TTTGTGGCCCACAGTGGCAGTGG + Intergenic
1058604326 9:106704626-106704648 TTTCATCTCCTCTGGGGCAGAGG - Intergenic
1059463919 9:114453381-114453403 TGTGATCCCCAGTGTTGGAGGGG - Intronic
1059966235 9:119617027-119617049 TGTGATGCACACTGGGGCAGAGG + Intergenic
1061984434 9:134121699-134121721 TTTGATCCCCAGTGTTGGAGGGG - Intergenic
1062304531 9:135896797-135896819 CCTAATCCCCAATGTGGCAGTGG + Intronic
1187260566 X:17681937-17681959 TTTGTTCCCCACTATGGATGAGG - Intronic
1191570798 X:62615738-62615760 TTTGAGCCCTACTGTGGAAAAGG + Intergenic
1191782629 X:64885220-64885242 TTTGATCCACACTGGGGATGGGG + Intergenic
1192079588 X:68033704-68033726 TGTGATCCCCAGTGTTGAAGTGG + Intergenic
1192523607 X:71823339-71823361 GTGGTTCCCCACTGGGGCAGGGG + Intergenic
1193563627 X:83050574-83050596 TTTGATCCACAGTGTAGCAATGG + Intergenic
1194414194 X:93590299-93590321 TTTGATCCCCAGTGTTGGAGAGG - Intergenic
1194428011 X:93763604-93763626 TTTTATCCCCAATTTGGCAGTGG - Intergenic
1195839489 X:109157404-109157426 TTTGATCCCAATTATGGCCGTGG - Intergenic
1199638901 X:149841127-149841149 TGTGATCCCCAGTGTTGGAGTGG - Intergenic
1202384723 Y:24314762-24314784 TGTGATCCCCATTGTTGGAGGGG - Intergenic
1202486061 Y:25355360-25355382 TGTGATCCCCATTGTTGGAGGGG + Intergenic
1202592442 Y:26500719-26500741 TTTGATCCCCAATGTTGGAGGGG + Intergenic