ID: 1029236978

View in Genome Browser
Species Human (GRCh38)
Location 7:99128675-99128697
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029236976_1029236978 8 Left 1029236976 7:99128644-99128666 CCACGCATTGCTTTCAAATATCA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1029236978 7:99128675-99128697 CTTTCTAAACTGAATGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr