ID: 1029237008

View in Genome Browser
Species Human (GRCh38)
Location 7:99129098-99129120
Sequence TTTTAGGGCTGCCTCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029237008 Original CRISPR TTTTAGGGCTGCCTCTGACT TGG (reversed) Intronic
901186772 1:7378785-7378807 GTTTAGTGCGGCCTCTGACTCGG - Intronic
901534948 1:9876292-9876314 TTTTTGGCTTACCTCTGACTTGG - Intronic
903221410 1:21871568-21871590 TTGAAGGGCAGCCTCTGACCTGG + Intronic
903535699 1:24064804-24064826 GTTAAGAGCTGCCTCTGTCTTGG - Intronic
904686266 1:32263010-32263032 ATTCGAGGCTGCCTCTGACTAGG + Intronic
906259488 1:44376044-44376066 TTTCATTGCTGCCTCTGAATTGG + Intergenic
906825566 1:48975899-48975921 TTTCAGGGATACCTCTGATTTGG - Intronic
907646627 1:56251056-56251078 TTTCAGAGCTGCTTCTGACCTGG - Intergenic
907848483 1:58231272-58231294 TTTTAGGGCTATATCTGAGTTGG - Intronic
908357333 1:63335681-63335703 GTTTAGTGCTGCCTATGGCTGGG + Intergenic
908551598 1:65214053-65214075 TGCTAGGGCTGCCACAGACTGGG - Intronic
908662676 1:66454073-66454095 TTTTAGGGTAGCTTCTGACAAGG - Intergenic
911401928 1:97386038-97386060 TGGTGGGGCAGCCTCTGACTGGG + Intronic
912411402 1:109483210-109483232 TTCTGGGGCTGGCTCTGGCTCGG + Intergenic
912478948 1:109963058-109963080 TGTGAGGCCTCCCTCTGACTGGG - Intergenic
914337811 1:146731575-146731597 TTTTATGGCTGCATCTCGCTGGG + Intergenic
919907231 1:202086261-202086283 CACTATGGCTGCCTCTGACTGGG - Intergenic
920584166 1:207141352-207141374 TTTTCATGCTGCCTCTGACAGGG - Intronic
920591746 1:207226031-207226053 TCTAAGTGCTGCCTCTGTCTAGG - Intergenic
922171485 1:223159359-223159381 TTTCATGTCTGCCTCTGATTGGG + Intergenic
922548501 1:226476279-226476301 TGCCAGGGCTGCCTCTCACTCGG + Intergenic
923475427 1:234327023-234327045 TCTTAGGGACGGCTCTGACTTGG - Intergenic
1066177532 10:32924631-32924653 TCTCTGGGCTGCCTCTAACTAGG - Intronic
1067146064 10:43694768-43694790 ATTCAGGGCTGCCTCTGCCTGGG + Intergenic
1069162599 10:65109563-65109585 TCTGAGGGCTGTCTCTGACACGG + Intergenic
1069308102 10:66997752-66997774 TTTGAGGACTTCCTCTGCCTGGG - Intronic
1069710234 10:70483319-70483341 TTTAAGGGGTGCCCCTGCCTGGG + Intronic
1069739086 10:70676024-70676046 TTTCGTGGCTGCCTCTGTCTAGG + Intronic
1069895137 10:71675880-71675902 TTAGAGGGCTGCCTTTGGCTTGG - Intronic
1070360486 10:75683876-75683898 TCACAGAGCTGCCTCTGACTAGG + Intronic
1070525726 10:77294321-77294343 TTATAGTTCTGCCTCTGACAAGG - Intronic
1071363895 10:84879067-84879089 TATTAGAGCTGCCTCTGGATGGG - Intergenic
1071755187 10:88529328-88529350 TTCTAGTGCTGCCTCTGACTGGG + Intronic
1073789842 10:106928592-106928614 TCTCAGCGCTGCCTCTGCCTGGG - Intronic
1073967182 10:109004090-109004112 TTAAAGAGCTGCCTGTGACTGGG + Intergenic
1075104295 10:119527713-119527735 CTTGAGGGCTGCCTCTGAATTGG - Intronic
1075345170 10:121676595-121676617 TTTTAGAGCTGTCTGTGAGTTGG + Intergenic
1075693121 10:124413862-124413884 TTTTAGGGCTGGGGGTGACTGGG - Intronic
1075957527 10:126536753-126536775 TTTCAGGGCTGCCTTTGAATGGG - Intronic
1077797213 11:5505321-5505343 CTCTGGGTCTGCCTCTGACTGGG - Intronic
1078880820 11:15447151-15447173 TGTGAGGGCTGCATTTGACTGGG - Intergenic
1079139810 11:17800879-17800901 TTTAAGGCCTGCCTCTCCCTTGG - Intronic
1083112368 11:60423918-60423940 TTCTAGTACTGCCTCTGCCTAGG - Intergenic
1084223910 11:67702994-67703016 TATGAGGGCGGCCTCTGACGCGG - Intergenic
1085684413 11:78608740-78608762 TGTTAGGGCTGCTTCTACCTAGG + Intergenic
1086746921 11:90440434-90440456 TTTCAGGGCTACCCCTGAGTAGG - Intergenic
1087444558 11:98233648-98233670 GATCAGTGCTGCCTCTGACTGGG - Intergenic
1088434419 11:109795259-109795281 TTTTATGACTGTCTCTTACTTGG + Intergenic
1090176482 11:124654284-124654306 TTTCAGGGCTAACTCTGATTTGG - Intronic
1090340711 11:126017540-126017562 CTTTAGGGCTACTTCTGAATTGG + Intronic
1090958895 11:131538338-131538360 TCTCAGGGCTGCCACTAACTAGG - Intronic
1093980730 12:25472426-25472448 GTTTAGGGCAGCTGCTGACTGGG + Intronic
1096106738 12:49000419-49000441 CTTTTGGGCTGCCTCTGTCCTGG + Intergenic
1101376263 12:104173783-104173805 CATTAGAACTGCCTCTGACTAGG + Intergenic
1108388830 13:49927709-49927731 TTTTAGAGCTGCCACTGGCTGGG - Intronic
1118320914 14:64752893-64752915 ATCTAGGGCTGTCTCTGCCTGGG - Intronic
1121972325 14:98369697-98369719 ATTTAAGGCTTCCTCTAACTTGG + Intergenic
1126304288 15:47237531-47237553 TTTCAACGCTGCCTCTAACTCGG + Intronic
1130568535 15:85019965-85019987 TTTTTTGGCTTCCTGTGACTAGG + Intronic
1137608145 16:49800724-49800746 TTTAAGGGCTCCCTCTGAGGGGG - Intronic
1139263524 16:65618429-65618451 TTTCAGGGCTAGCTCTGAATTGG + Intergenic
1139996468 16:70985758-70985780 TTTTATGGCTGCATCTCGCTGGG - Intronic
1141335619 16:83152575-83152597 TTTTAGGGCTGCCATTCAATTGG + Intronic
1141831493 16:86511960-86511982 CTGGAGGGCTGCCTCTGCCTGGG + Intronic
1142130646 16:88430224-88430246 TTTTGGGCCTGCCTCGGGCTGGG - Exonic
1144243213 17:13334887-13334909 ATCTAGGTCTCCCTCTGACTAGG - Intergenic
1147161172 17:38570179-38570201 TTCCAGGGCTGTTTCTGACTGGG - Intronic
1149326935 17:55540910-55540932 ATTTATGGCTTCCTGTGACTTGG + Intergenic
1150617774 17:66785277-66785299 CTCAACGGCTGCCTCTGACTTGG + Intronic
1150621319 17:66809781-66809803 TTCCAGGGCTGCCTCTGGATGGG - Exonic
1151082327 17:71343191-71343213 TTTTAGCCCAGGCTCTGACTTGG + Intergenic
1151400221 17:73851057-73851079 TTTCAGGGCTGTCTATGCCTGGG - Intergenic
1157414049 18:47487460-47487482 TTTTGGTCCTGCCTCTGACATGG - Intergenic
1158101825 18:53838142-53838164 TTTTAGGGGTGCCTCTCCTTTGG + Intergenic
1158133878 18:54184278-54184300 ATTTAATGCTGCCTCTGATTGGG - Intronic
1161361008 19:3849692-3849714 TTGTAGGCTGGCCTCTGACTTGG + Intronic
1161707720 19:5829816-5829838 TTTCAGGGCTGCCGCTGGCTGGG + Intergenic
1163236693 19:16034160-16034182 TGATTGGGCTCCCTCTGACTAGG - Intergenic
1163303120 19:16460508-16460530 TTTTAGGCCAGCCTCTGAGTTGG - Intronic
1166495577 19:43300891-43300913 TGTTTGATCTGCCTCTGACTGGG - Intergenic
1167621842 19:50565081-50565103 TCTCAGGGCTGTCTCTGAGTGGG + Intronic
1168723494 19:58568403-58568425 TTTCTGGGATGCCTCTTACTTGG - Intronic
925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG + Intergenic
925869848 2:8260494-8260516 TTCCAGAGCTGCCTCTTACTGGG + Intergenic
926741550 2:16115366-16115388 TTTAAGGGCTGGTTCTGACAAGG - Intergenic
927439010 2:23096828-23096850 TAAGAGGGCTGCTTCTGACTTGG + Intergenic
927555688 2:24029950-24029972 TTTTAGGACTACCTCAGATTCGG + Exonic
928970306 2:37021412-37021434 TTTTAGGGCTGGTTCTTAGTGGG - Intronic
929809854 2:45180456-45180478 TTGTAGGCATCCCTCTGACTGGG + Intergenic
929946771 2:46377820-46377842 TTTTTGGGCCTCCTCTGCCTTGG + Intronic
932882209 2:75513513-75513535 TTTTATTTCTGTCTCTGACTGGG + Intronic
937431802 2:121844951-121844973 ATTTAGGATTGCCTCGGACTAGG - Intergenic
937447414 2:121970771-121970793 TTTTAGGTTTGCCTGTGACTCGG + Intergenic
937708333 2:124948179-124948201 CTTTAGGTTTACCTCTGACTTGG - Intergenic
938092240 2:128441398-128441420 TGTTGGGGCTGCCCCTGGCTGGG + Intergenic
938561171 2:132473241-132473263 TTTTAGAGCTTCCAGTGACTTGG - Intronic
939019037 2:136937127-136937149 TTTGTGGGCTGCCTGTGGCTGGG - Intronic
939105413 2:137943255-137943277 TCTTTGTGCTGCCCCTGACTCGG + Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945823521 2:214693306-214693328 TTTTTGGCCTGCCACTTACTTGG - Intergenic
946994915 2:225380351-225380373 TTTTGGGGGTGTCTCTGATTTGG + Intergenic
948148184 2:235724195-235724217 ATTCAGGGCTGCCTCAGCCTTGG - Intronic
1169364276 20:4978624-4978646 TTCTGGGGCTGCCTCCAACTGGG - Intronic
1172049971 20:32109870-32109892 CCTGAGGGCTACCTCTGACTGGG + Intronic
1172160439 20:32864286-32864308 TTAAAGGGCTGCCTGAGACTGGG + Intronic
1172193363 20:33075590-33075612 ATTTAAGGCTGCCTGTGACCTGG + Intergenic
1172805350 20:37607867-37607889 TTTCAGGGCTGTCTCTCTCTAGG + Intergenic
1173286074 20:41672404-41672426 TTTTGGGGATCCCTCTGACTGGG + Intergenic
1174538883 20:51274054-51274076 TTTTAAGGCTGCCTGAGTCTTGG + Intergenic
1182866411 22:33608044-33608066 TTGTCCTGCTGCCTCTGACTTGG - Intronic
1184607001 22:45579946-45579968 TTTCAGGGCTGCTTCAGGCTGGG - Intronic
949625667 3:5863950-5863972 TTTTAGGCCTGGCTGGGACTTGG - Intergenic
951998749 3:28760401-28760423 TTTTAGGGCTTCCTTTAACTGGG + Intergenic
952163361 3:30718858-30718880 TTTTAGGGATGGGGCTGACTTGG - Intergenic
955146306 3:56323546-56323568 TCTTAGGGCTGGCTTTGGCTGGG - Intronic
958103288 3:89041689-89041711 TTTTAGAGGTGCCTGTGGCTAGG + Intergenic
959437073 3:106328906-106328928 TTTTTAGCCTGGCTCTGACTGGG - Intergenic
959872954 3:111349811-111349833 TTTTAGGGCTAACTATGACATGG + Intronic
960464958 3:117986308-117986330 TTACTGTGCTGCCTCTGACTGGG - Intergenic
964164085 3:153680628-153680650 TGTGAAGGCTGCCTCTGAGTGGG - Intergenic
967068629 3:185942611-185942633 TTTGAGTGCAGCCTCTGGCTTGG - Intergenic
967541567 3:190674171-190674193 TTTTATAGTTGCCTCTGCCTAGG - Intergenic
967543659 3:190698270-190698292 TTTGAGGGCAGCCTCTGATTTGG - Intergenic
970492776 4:16591882-16591904 TTTTAAAGCTGCCTTTCACTTGG + Intronic
970589619 4:17547892-17547914 TGCTAGGGCTGCCACAGACTGGG - Intergenic
970941237 4:21636472-21636494 TTTTAGTGCTGCCTGGGTCTTGG - Intronic
971249118 4:24957490-24957512 TTTTAGGGCTGTACCTGAATGGG - Intronic
974764476 4:66324351-66324373 TTTACAGTCTGCCTCTGACTTGG - Intergenic
981182206 4:141758982-141759004 ATTTGGGGCTGCCTCTTATTAGG - Intergenic
981677776 4:147359688-147359710 TCTTAAGGCTCCCTCTCACTTGG - Intergenic
987504264 5:18748810-18748832 CATTAGGGCTGCCTCTATCTAGG + Intergenic
988696184 5:33624588-33624610 GTTCAGTTCTGCCTCTGACTCGG - Intronic
989993949 5:50804378-50804400 TTTTAAGGCTGCCACTGAGCTGG + Intronic
993838583 5:92847225-92847247 TTGTAGTACTGCCTCTGAGTCGG + Intergenic
1000186893 5:158867477-158867499 TTCCAGAGCTGCCTCTGACAGGG - Intronic
1001094445 5:168765497-168765519 ATTTCGGGCTGGCTCTGACTGGG - Intronic
1004485776 6:16065139-16065161 TGCTAGGGATGCCTTTGACTTGG - Intergenic
1004613315 6:17266684-17266706 TTTCAAGGCTGCCTCCGAATGGG - Intergenic
1004895527 6:20144170-20144192 TTTTACTGCTGACTTTGACTTGG - Intronic
1004990642 6:21134085-21134107 CTTTTGTGCTGCCTCTGGCTGGG + Intronic
1005591895 6:27337292-27337314 TGTTGAGGCTGCCTCTGAGTTGG + Intergenic
1007844349 6:44741241-44741263 CTTCTGGGCTGCCTCTGATTTGG - Intergenic
1012381961 6:98630817-98630839 CCTTAGGTCTGCCTCTGCCTGGG - Intergenic
1017059653 6:150470174-150470196 TTTCAGGGCTACCCCTGAGTGGG + Intergenic
1019463734 7:1175137-1175159 TTTCAGGGCCACCTCTGAGTGGG + Intergenic
1021894786 7:25223494-25223516 TTCTAGGAATGCCTCTTACTTGG - Intergenic
1022082867 7:27040823-27040845 TTGTAAGGCTGCCTCTCTCTTGG + Intergenic
1022476869 7:30716724-30716746 TTCCAGGGCTGCCTCTGACCTGG + Intronic
1022627678 7:32054749-32054771 TTTTAGGGCTGTGTCTAAATGGG - Intronic
1029237008 7:99129098-99129120 TTTTAGGGCTGCCTCTGACTTGG - Intronic
1029626063 7:101720866-101720888 TTTTAGTCCTGCCTCTGAAGTGG + Intergenic
1033420465 7:141200548-141200570 TTCCAGGGCTCCCTCTAACTGGG - Intronic
1034190235 7:149208041-149208063 TTCTAGGCCTGCCTCTGCCTTGG + Intronic
1034820313 7:154211101-154211123 TGTTAGTGCTTCCTCTTACTTGG + Intronic
1035038985 7:155913927-155913949 TTTGAGGGGTGCTTCTGCCTTGG + Intergenic
1038324857 8:26565351-26565373 TTTTAGGGCTGCCCCAGGATTGG + Intronic
1042793697 8:72636936-72636958 CTGTGGGGCTGCCTCTGATTTGG - Intronic
1044297108 8:90541578-90541600 TTTCACTGCTGCCTCTGAATGGG - Intergenic
1046542104 8:115598882-115598904 TTTTAAGGATGTCTCTGCCTTGG + Intronic
1046651748 8:116843237-116843259 GATTAGGTCTGCCTCTAACTAGG - Intronic
1047432837 8:124807440-124807462 TTTTAGGGTTGCCTTTTATTTGG + Intergenic
1049305888 8:141903790-141903812 TCCTAGGGCCGCCTCTGTCTGGG - Intergenic
1050138453 9:2492922-2492944 TGTTAGGATTGCCTCAGACTGGG + Intergenic
1050772813 9:9224420-9224442 TTCTAAGACTGCCTCTGATTTGG + Intronic
1050872542 9:10591826-10591848 TGCTAGGGCTGCCTGTGACATGG - Intronic
1050895279 9:10879034-10879056 TTTTTGTCCTGCCACTGACTGGG + Intergenic
1052446686 9:28571163-28571185 TTTCATGGCTGCTTATGACTTGG + Intronic
1057950680 9:99366917-99366939 TTTTAGGGATGAATGTGACTTGG + Intergenic
1059204508 9:112451668-112451690 TTTTAAGTCTGCGTCTGGCTTGG + Intronic
1059247620 9:112862099-112862121 TTTTAGGACTGCCTGAGCCTCGG - Intronic
1059938345 9:119334033-119334055 ATTTAGAGCTGCCTCTGTCAGGG - Intronic
1061678986 9:132233361-132233383 TTGCAGAGCTGCTTCTGACTTGG + Intronic
1062269851 9:135703405-135703427 TTTAAGGGCTGCCTCTGGTGAGG + Intronic
1185915332 X:4028263-4028285 TTTTAAGGCAGCCTCTGCATGGG - Intergenic
1190093001 X:47455982-47456004 CTTGAAGGCAGCCTCTGACTTGG + Exonic
1199433203 X:147784025-147784047 GTTTAGGGCTGCCTATGACCAGG + Intergenic
1199889908 X:152068454-152068476 TTTCAGGGCTACCTCTGAGTGGG - Intergenic
1200253323 X:154565290-154565312 TTTTAGTTCTGCTTCTGAATGGG + Intergenic
1200264444 X:154639125-154639147 TTTTAGTTCTGCTTCTGAATGGG - Intergenic