ID: 1029238636

View in Genome Browser
Species Human (GRCh38)
Location 7:99143516-99143538
Sequence GAGGGGGCGCGAGCGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029238636 Original CRISPR GAGGGGGCGCGAGCGGCCAG GGG Intronic