ID: 1029238695

View in Genome Browser
Species Human (GRCh38)
Location 7:99143668-99143690
Sequence GAATTCCGGGGCGGGCGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 510}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029238680_1029238695 1 Left 1029238680 7:99143644-99143666 CCGCTTCCAAGGGCGCCCTGCGG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1029238695 7:99143668-99143690 GAATTCCGGGGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 55
4: 510
1029238671_1029238695 30 Left 1029238671 7:99143615-99143637 CCTGGGACAACGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1029238695 7:99143668-99143690 GAATTCCGGGGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 55
4: 510
1029238677_1029238695 17 Left 1029238677 7:99143628-99143650 CCGGCGTGGGGGAGGGCCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1029238695 7:99143668-99143690 GAATTCCGGGGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 55
4: 510
1029238684_1029238695 -5 Left 1029238684 7:99143650-99143672 CCAAGGGCGCCCTGCGGGGAATT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1029238695 7:99143668-99143690 GAATTCCGGGGCGGGCGAGGGGG 0: 1
1: 0
2: 0
3: 55
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029238695 Original CRISPR GAATTCCGGGGCGGGCGAGG GGG Intronic
900121783 1:1051397-1051419 GGCCTCCGGGGCGGGCGGGGTGG + Intronic
900640036 1:3684227-3684249 GAATCCCTGGGCGGCGGAGGCGG - Intronic
901607680 1:10472250-10472272 GACGTCCGGCGGGGGCGAGGCGG - Intronic
901625372 1:10621630-10621652 GAATTCTTGGCCGGGCGCGGTGG - Intronic
902928950 1:19716898-19716920 GAATCCAGGGCCGGGCGCGGTGG + Intronic
903055866 1:20635559-20635581 AAATTCTGGGCCGGGCGGGGTGG + Intronic
903397891 1:23016189-23016211 GAATTCCTGGCCGGGTGTGGTGG - Intergenic
903827682 1:26157322-26157344 CACTTTCGGGCCGGGCGAGGTGG - Intergenic
904089787 1:27936729-27936751 GAATTCCGGGCCGGATGCGGTGG + Intronic
905584382 1:39105464-39105486 GACTGCCGGGCCGGGCGAGGCGG + Intronic
905602419 1:39264959-39264981 GAAATCCTGGCCGGGCGCGGTGG - Intronic
905788794 1:40779101-40779123 AAATTCCTTGGCTGGCGAGGTGG + Intergenic
906162557 1:43661319-43661341 GAATTCCAGGCCGGGTGTGGTGG + Intronic
906473096 1:46147390-46147412 GAGTTCCTGGCCGGGCGTGGTGG - Intronic
906487943 1:46246245-46246267 GAATTCTGGGCCGGGCGCGGTGG - Intergenic
908167009 1:61468657-61468679 GATTTCCCGGCCGGGCGCGGTGG - Intergenic
909019732 1:70417570-70417592 GAATTTCAGGGCAGGCGTGGTGG - Intronic
911364442 1:96919758-96919780 AAATTCCCGGCCGGGCGCGGTGG - Intergenic
911592829 1:99767666-99767688 GAACTCCGGGCTGGGCGCGGTGG - Intergenic
911732998 1:101309224-101309246 GAAATCCGGGGGGGGGGGGGAGG + Intergenic
911933213 1:103931724-103931746 GAATTCACGGCCGGGCGCGGTGG - Intergenic
912836574 1:113001662-113001684 GAGTTCCAGGCCGGGCGCGGTGG - Intergenic
912992317 1:114500901-114500923 GAATTTGGGGCCGGGCGCGGTGG + Intronic
913115048 1:115689342-115689364 GGATACCGGGCCGGGCGCGGTGG + Intronic
913454419 1:119016454-119016476 GAATTACTGGCCGGGCGCGGTGG - Intergenic
913536621 1:119779021-119779043 GAATTCCAGGCCGGGCGCGGTGG - Intergenic
914847652 1:151291727-151291749 GAAATCCGGGGCGGGGGGGTGGG + Exonic
914862578 1:151398950-151398972 GACTTCTAGGCCGGGCGAGGCGG + Intergenic
914896261 1:151676591-151676613 AAATTCCTGGCCGGGCGTGGTGG - Intronic
915464225 1:156086926-156086948 TAATTCCTGGCCGGGCGCGGTGG - Intronic
916420372 1:164632384-164632406 GATTTCAGGGGAGGGTGAGGGGG + Intronic
917377423 1:174364539-174364561 GAAATCCAGGCCGGGCGCGGTGG - Intronic
917552537 1:176048883-176048905 GAATTAAGGGCCGGGCGCGGTGG + Intronic
920109341 1:203576005-203576027 AAATTCCGGGCTGGGCGCGGTGG + Intergenic
920526585 1:206671413-206671435 GAATTCCAGGCTGGGCGCGGTGG - Intronic
921107901 1:212001336-212001358 GAATTCTGGGCCGGGCGTGGTGG - Intronic
922409868 1:225362285-225362307 TACTTCCGGGCCGGGCGCGGTGG + Intronic
923984534 1:239366108-239366130 GACTTCTGGGGAGGGGGAGGTGG + Intergenic
924855660 1:247872940-247872962 GAACTCTGGGCCGGGCGCGGTGG + Intronic
1063946074 10:11177785-11177807 GAACTCAGGAGCGGGTGAGGAGG + Intronic
1064130912 10:12708926-12708948 CAACTCCGGGTCGGGCGTGGTGG - Intronic
1065211703 10:23410365-23410387 GAATGCCAGGCCGGGCGCGGTGG + Intergenic
1065588075 10:27240033-27240055 TAAATCCGGGCCGGGCGCGGTGG - Intronic
1065845300 10:29738143-29738165 GACTTCAGGGCCGGGCGCGGTGG + Intergenic
1066106337 10:32160611-32160633 GGATTCCGGGGCAGTGGAGGTGG + Intergenic
1069816719 10:71200995-71201017 AAATTCCAGGCCGGGCGTGGTGG + Intergenic
1070193513 10:74133938-74133960 GAAGTCCTGGCCGGGCGCGGTGG - Intronic
1070904526 10:80060043-80060065 TAACTCCTGGCCGGGCGAGGTGG + Intergenic
1071150112 10:82623960-82623982 GAATTCAGAGGAGGGCAAGGAGG - Intronic
1071330498 10:84554083-84554105 GAATTCTGGGCTGGGCGTGGTGG + Intergenic
1071817485 10:89248150-89248172 AAATTCCTGGGCAGGCGCGGTGG - Intronic
1072708350 10:97698509-97698531 GAATACCAGGCCGGGCGTGGTGG + Intergenic
1073354882 10:102846018-102846040 GAATTCCTGGCCGGGCATGGTGG + Intergenic
1074860359 10:117505320-117505342 CAATTCCTGGTCGGGGGAGGTGG + Intergenic
1075200066 10:120395102-120395124 GAGTTCAGGGCCGGGCGCGGTGG + Intergenic
1075704410 10:124491249-124491271 GAATTCCGAGGCGGTGGCGGAGG + Intronic
1076704833 10:132295596-132295618 GAATTCCAGGCCGGGCGCAGTGG + Intronic
1077079351 11:717589-717611 CAATTCCTGGCTGGGCGAGGTGG + Intronic
1078228954 11:9421246-9421268 GAATTCTGGGCCGGGGGTGGGGG - Intronic
1078232909 11:9459229-9459251 GTAATCCGGGCCGGGCGCGGTGG + Intergenic
1080459055 11:32437896-32437918 GAAGTCCAAGTCGGGCGAGGGGG - Intergenic
1080475290 11:32584318-32584340 AAATGCCGGGCCGGGCGCGGTGG + Intronic
1080864101 11:36178289-36178311 GAAATCCTGGGCTGGAGAGGAGG - Intronic
1081192915 11:40126671-40126693 GAATTTGGGGACGGGCGTGGTGG + Intronic
1082076705 11:47980759-47980781 GAAGCCCGGGGCGGGCGGAGCGG + Exonic
1082083106 11:48027292-48027314 GTATTCCGGGCCGGGCGCGGTGG - Intronic
1083182192 11:60994151-60994173 GAATTTCTGGCCGGGCGCGGTGG + Intronic
1083647730 11:64182497-64182519 GAATTCTGGGTTGGGCGCGGTGG + Intergenic
1087532724 11:99405600-99405622 GAATTCCTGGCCGGGCGCGGTGG + Intronic
1087884195 11:103459020-103459042 AAATTCCAGGCCGGGCGCGGTGG + Intronic
1088305976 11:108408385-108408407 AAATTCTGGGCCGGGCGTGGTGG + Intronic
1088485573 11:110337149-110337171 GAATTCAGGGCCAGGCGCGGTGG + Intergenic
1088874186 11:113920313-113920335 GAATTCTGGGCCAGGCGCGGTGG - Intronic
1088885491 11:114003110-114003132 GAATTCTTGGCCGGGCGCGGTGG + Intergenic
1089027804 11:115289880-115289902 AAATTCAGGGCCGGGCGCGGTGG - Intronic
1089503159 11:118944718-118944740 AAATTCCTGGCCGGGCGCGGTGG - Intronic
1089786566 11:120911522-120911544 GAATTTTGGGCCGGGCGCGGTGG - Intronic
1090022667 11:123141469-123141491 GAATGCCTGGCCGGGCGCGGTGG - Intronic
1090086310 11:123654088-123654110 GAGTTCCGGGGTGGGCGGGGAGG - Exonic
1090422552 11:126585519-126585541 TAATTCCTGGCCGGGCGCGGTGG - Intronic
1091318332 11:134631954-134631976 GACATCCTGGTCGGGCGAGGTGG - Intergenic
1091454803 12:599092-599114 GTATTCCAGGCCGGGTGAGGTGG + Intronic
1091591057 12:1843208-1843230 GGATTCCGGAGGGGGCGGGGTGG + Intronic
1092376820 12:7962743-7962765 GAATCCGGGGCCGGGCGCGGTGG + Intergenic
1093716774 12:22391792-22391814 GAAGTCTGGGCCGGGCGCGGTGG + Intronic
1094482872 12:30898788-30898810 GGATTATGGGGCGGGGGAGGTGG + Intergenic
1094603884 12:31934040-31934062 GAATTTCGGGCCGGGTGTGGTGG - Intergenic
1094766925 12:33607286-33607308 GAATTGCAGGCTGGGCGAGGTGG - Intergenic
1095450904 12:42329390-42329412 AAATTCCAGGCCGGGCGCGGTGG - Intronic
1095541011 12:43308586-43308608 GCATTCCGGGCCAGGCGCGGTGG + Intergenic
1095898172 12:47301477-47301499 CAACTCCTGGCCGGGCGAGGTGG - Intergenic
1096009114 12:48198196-48198218 GCAATTCGGCGCGGGCGAGGCGG + Intergenic
1096133685 12:49181775-49181797 GAATTCTGGGCCGGGCGCAGTGG + Intergenic
1096273424 12:50185115-50185137 GAATTCCGGGCCAGGCGCAGTGG - Intronic
1096448763 12:51719787-51719809 GAATTCTTGGCCGGGCGCGGTGG + Intronic
1096631612 12:52930506-52930528 GAATTGGGGGCCGGGCGTGGTGG - Intronic
1097077871 12:56408620-56408642 GATTTCCAGGCCGGGCGCGGTGG - Intergenic
1097089056 12:56490916-56490938 TAAATCCGGGCCGGGCGCGGTGG + Intergenic
1097854558 12:64448909-64448931 AAATTCCAGGCCGGGCGTGGTGG + Exonic
1098814325 12:75138691-75138713 GGATTCCGGGCTGGGCGCGGTGG + Intronic
1101656709 12:106727904-106727926 GAATTCAGGGCCGGGCGCGGTGG - Intronic
1101699118 12:107155028-107155050 AAATTCTGGGCCGGGCGCGGTGG - Intergenic
1103785319 12:123428421-123428443 TAATTCAGGGCCGGGCGCGGTGG - Intronic
1103874926 12:124119741-124119763 GAAAACCGGGCCGGGCGCGGTGG + Intronic
1105633956 13:22199337-22199359 GAAAACCGGGGCGGTGGAGGGGG - Intergenic
1107727828 13:43317716-43317738 AAATTCCGGGCCAGGCGTGGTGG + Intronic
1108380082 13:49846885-49846907 GAATTGCCGGCCGGGCGCGGTGG + Intergenic
1108950543 13:56087286-56087308 GATTTCCAGGGCAGGCGGGGGGG - Intergenic
1109123274 13:58485344-58485366 GAACTCTGGGCCGGGCGCGGTGG - Intergenic
1109226049 13:59697170-59697192 GGATTCAGGGCCGGGCGCGGTGG + Intronic
1110049258 13:70873901-70873923 GGATTCCTGGCCGGGCGCGGTGG - Intergenic
1112271519 13:97974595-97974617 GAATTACAGGCCGGGCAAGGTGG - Intronic
1112514810 13:100044296-100044318 GATTTCCTGGCCGGGCGCGGTGG - Intergenic
1113056031 13:106269049-106269071 AAATTCTGGGCCGGGCGTGGTGG + Intergenic
1113079397 13:106501877-106501899 AAATTCTGGGCCGGGCGCGGTGG - Intronic
1114302059 14:21387196-21387218 GAATTCTGGGCCAGGCGTGGTGG + Intronic
1114651631 14:24288633-24288655 CAATTCCTGGTCGGGCGCGGTGG - Intergenic
1115220988 14:31058215-31058237 GAATACGGGGCCAGGCGAGGTGG - Intronic
1115555722 14:34543722-34543744 AAATTCTGGGCCGGGCGCGGTGG - Intergenic
1115558186 14:34559371-34559393 AAATTCTGGGCCGGGCGCGGTGG + Intergenic
1116633599 14:47364549-47364571 TAATTCTGGGGCCGGCGCGGTGG - Intronic
1116887327 14:50233624-50233646 CCATTCAGGGCCGGGCGAGGTGG + Intergenic
1117229871 14:53705559-53705581 TAATTCCTGGCCGGGCGTGGTGG - Intergenic
1117530074 14:56652206-56652228 GAATTCAGGGCCGGGAGTGGTGG + Intronic
1117813870 14:59577227-59577249 GACGTCTGGGCCGGGCGAGGTGG + Intergenic
1117909379 14:60622158-60622180 GAATTCCAAGGCTGGCAAGGTGG - Intergenic
1117973915 14:61280005-61280027 GAATTGGGTGACGGGCGAGGAGG + Exonic
1119040692 14:71271761-71271783 GAATTATGGGCCGGGCGTGGTGG + Intergenic
1119241445 14:73063434-73063456 AAACTCCGGGCCGGGCGCGGTGG - Intronic
1119321407 14:73733298-73733320 TAATTCAGGGCCGGGTGAGGTGG + Intronic
1120235666 14:81887939-81887961 GAATTCCTGGCCAGGCGCGGTGG - Intergenic
1121352743 14:93186154-93186176 GAATTCTAGGCCGGGCGCGGTGG - Intronic
1121390185 14:93566902-93566924 GAATTCCAGGCCGAGCGTGGTGG - Intronic
1122538523 14:102483136-102483158 GGCTTCTGGGCCGGGCGAGGTGG - Intronic
1123587696 15:21773802-21773824 GAATCCAGGGCCAGGCGAGGTGG + Intergenic
1123624334 15:22216367-22216389 GAATCCAGGGCCAGGCGAGGTGG + Intergenic
1123765982 15:23478595-23478617 GTATTCCCGGCCGGGCGCGGTGG - Intergenic
1124391617 15:29263869-29263891 GAACTCCTGGGTGGGCGCGGTGG + Intronic
1124446658 15:29740260-29740282 GAATTCCGGGCCGGGCGCAGTGG - Intronic
1124798323 15:32804432-32804454 GAATTCGGGGGGGGGGGGGGGGG + Intronic
1125048387 15:35269722-35269744 GAAGTCCTGGCCGGGCGCGGTGG - Intronic
1125576097 15:40756591-40756613 GAACCCAGGGGCGGGGGAGGAGG - Intergenic
1125650461 15:41312913-41312935 GAATTCCTGGCCGGGCGTGGTGG - Intronic
1125886263 15:43231827-43231849 GACTTCCAGGCCGGGCGCGGTGG - Intergenic
1125921234 15:43527061-43527083 GGATTCCGGGGCAGGTGTGGGGG - Exonic
1127695621 15:61443934-61443956 GAATTTCAGGCCGGGCGCGGTGG + Intergenic
1127852298 15:62924468-62924490 AAATTGCGGGCCGGGCGCGGTGG - Intergenic
1128691789 15:69729969-69729991 TAATTCCTGGCCGGGCGCGGTGG - Intergenic
1129082392 15:73052415-73052437 ACATTCCGGGGCGGGGGGGGGGG - Intronic
1129795543 15:78373425-78373447 GAATTCTGGGCCGGGCATGGTGG - Intergenic
1129869064 15:78929299-78929321 GAATTCCGGCGGGAGGGAGGTGG + Intronic
1129993639 15:79986156-79986178 GAATTTCTGGCCGGGCGTGGTGG - Intergenic
1131283871 15:91041788-91041810 GAACTCAGGGCCGGGCGAGGTGG - Intergenic
1132576805 16:668108-668130 GAAGTGCGGGGCGGGCGCGGGGG + Exonic
1132737054 16:1391973-1391995 GAACTCAGGGCCGGGCGCGGTGG - Intronic
1133139510 16:3733927-3733949 GACTTCCAGGCCGGGCGTGGTGG - Intronic
1133493413 16:6293880-6293902 GAATTCCAGGGTGAGCGGGGGGG + Intronic
1134034191 16:11016989-11017011 GAATATCGGGGCGGGGGGGGGGG + Intronic
1134733345 16:16480229-16480251 GAATTCAGGGCCGGGCGCGGTGG - Intergenic
1134738990 16:16525472-16525494 GAATTCCAGGCCCGGCGCGGTGG - Intergenic
1134928511 16:18186680-18186702 GAATTCCAGGCCCGGCGCGGTGG + Intergenic
1135717915 16:24788933-24788955 GAATTTTGGGCCGGGCGTGGTGG - Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1135766762 16:25184415-25184437 GAAATCCAGGCCGGGCGTGGTGG - Intergenic
1136069964 16:27781811-27781833 GAAGACCGAGCCGGGCGAGGTGG - Intergenic
1136076614 16:27821611-27821633 GAATTTTGGGCCGGGCGCGGTGG + Intronic
1136261731 16:29082080-29082102 GCCTTCCGGGGCCGGGGAGGTGG + Intergenic
1136360998 16:29779650-29779672 GAATTCCTGGCTGGGCGCGGTGG + Intronic
1136521679 16:30800762-30800784 GAATTCATGGCCGGGCGTGGTGG - Intergenic
1136622858 16:31442011-31442033 GGACTCCGGGACGGGGGAGGCGG + Intronic
1137253343 16:46756195-46756217 GAACTCTGGGCTGGGCGAGGTGG - Intronic
1137446360 16:48534886-48534908 GAGTTCCTGGGCTGGGGAGGTGG + Intergenic
1137618253 16:49859007-49859029 GAAAGCCTGGGCGGGCGAGCTGG - Intergenic
1138160811 16:54752020-54752042 GCATTTGGGGGCGGGCGCGGTGG - Intergenic
1138923728 16:61565629-61565651 GAATTCCAGGCTGGGCGTGGTGG + Intergenic
1139080932 16:63520083-63520105 GAATTCCCGGCTGGGCGTGGTGG + Intergenic
1139097925 16:63727932-63727954 GAAGTCAAGGGCGGGCGCGGTGG - Intergenic
1139868752 16:70086165-70086187 GAAGTCCTGGCCGGGCGCGGTGG - Intergenic
1141695650 16:85617842-85617864 CAATTCCGGGGCAAGCAAGGCGG - Intronic
1141856788 16:86686881-86686903 GAATCTCGGGCCGGGCGCGGTGG - Intergenic
1142603584 17:1069783-1069805 GAGTCCAGGGGCGGGGGAGGGGG - Intronic
1142603600 17:1069832-1069854 GAGTCCAGGGGCGGGGGAGGGGG - Intronic
1142603617 17:1069881-1069903 CGAGTCCGGGGCGGGGGAGGGGG - Intronic
1142636171 17:1259242-1259264 GAACTCCAGGCCGGGCGCGGTGG - Intergenic
1142656752 17:1399743-1399765 GAGTCCCGGGGCGGGGGAGGGGG - Intronic
1142721472 17:1778898-1778920 GAACTCAGGGCCGGGCGCGGTGG + Intergenic
1143572144 17:7766062-7766084 GAAATGCGGGCCGGGCGCGGTGG - Intronic
1143582791 17:7836266-7836288 GAACGCCGGGGCGAACGAGGAGG - Intergenic
1144033320 17:11341619-11341641 GGATTCCTGGGCAGGCGCGGTGG - Intronic
1144251931 17:13426227-13426249 GAATTCTGGGCCGGGCGTGGTGG + Intergenic
1144821310 17:18076595-18076617 GAACTCCTGGCCGGGCGCGGTGG + Intergenic
1146230200 17:31100853-31100875 GAATTCCGGGCCGGGCACGGTGG - Intronic
1146262400 17:31430644-31430666 AAACTCCAGGGCGGGCGCGGTGG - Intronic
1146340080 17:32011280-32011302 GAAATCCGGGCCGGGCATGGTGG - Intronic
1146704118 17:34987905-34987927 AAATTCTGGGCCGGGCGCGGTGG + Intronic
1146798248 17:35798109-35798131 GCATTCCTGGCCGGGCGTGGTGG - Intronic
1147440226 17:40443358-40443380 GGGAGCCGGGGCGGGCGAGGGGG - Intergenic
1148108979 17:45133816-45133838 AAATTCAGGGCCGGGCGCGGTGG - Intronic
1148285504 17:46387363-46387385 GAATTCTGGGGCAGGGGAGCAGG + Intergenic
1148307667 17:46604963-46604985 GAATTCTGGGGCAGGGGAGCAGG + Intronic
1148498724 17:48072296-48072318 CTATTACGGGCCGGGCGAGGTGG - Intronic
1148697482 17:49570000-49570022 GAATGGCGGGCCGGGCGCGGTGG - Intergenic
1148705516 17:49627134-49627156 AAATTCCTGGCCGGGCGTGGTGG - Intronic
1148923356 17:51060215-51060237 TAATTAAGGGCCGGGCGAGGTGG + Intronic
1149825442 17:59823974-59823996 GAATCCCGGGCCGGGCGCAGAGG + Intronic
1150120729 17:62599543-62599565 GAATTGCGGGGAGGGAGAGGAGG - Intronic
1150219040 17:63485491-63485513 CAATTTCGGGCCGGGCGCGGTGG + Intronic
1150553676 17:66234220-66234242 GTATTCCTGGCCGGGCGCGGTGG + Intronic
1150696414 17:67409369-67409391 GAATTTGGGGCCGGGCGCGGTGG - Intronic
1151316045 17:73323368-73323390 GAAGTCCTGGACGGGCGTGGTGG - Intergenic
1151755567 17:76073579-76073601 GAGTTCAGGGCCGGGCGCGGTGG - Intronic
1151851439 17:76692538-76692560 GACTTCCAGGCCGGGCGCGGTGG - Intronic
1152581314 17:81166557-81166579 GAACGCCGGGGTGGGGGAGGGGG + Intergenic
1153470742 18:5441749-5441771 GAATTCGAGGCCGGGCGCGGTGG - Intronic
1153896429 18:9566196-9566218 AAAATCTGGGCCGGGCGAGGTGG - Intronic
1154110001 18:11559669-11559691 GACTTCCCGGCCGGGCGCGGTGG + Intergenic
1155194074 18:23456226-23456248 GAAGTCCGGGCTGGGCGTGGTGG - Intronic
1155211388 18:23605206-23605228 GAATTCTGGGCCGGGCATGGTGG - Intronic
1155429571 18:25741588-25741610 CAATTCCAGGCCGGGCGTGGTGG + Intergenic
1155772500 18:29719947-29719969 GAATTCCTGGCCGGGCACGGTGG + Intergenic
1155806008 18:30172926-30172948 GAAATCAGGGTCGGGCGAGGTGG - Intergenic
1155927035 18:31667847-31667869 TAATTCCTGGGAGGCCGAGGCGG + Intronic
1155953879 18:31941153-31941175 GAATTCAAGGCCGGGCGCGGTGG + Intronic
1155972472 18:32094076-32094098 GATTTCCGGGCGGGGCGCGGTGG - Intronic
1157332175 18:46712073-46712095 GAACTCCGGGGTGGGGAAGGAGG - Intronic
1157846318 18:51007023-51007045 GCATTGCAGGGCGGGCGGGGGGG - Intronic
1158364615 18:56719274-56719296 GAATTGCTGGCCGGGCGCGGTGG + Intronic
1158482788 18:57836573-57836595 AAATTCAGGGCTGGGCGAGGTGG - Intergenic
1159024699 18:63172492-63172514 GAATTCCCGGCCGGGCGTGGTGG + Intronic
1159547062 18:69852440-69852462 GAATGCCAGGCCGGGCGCGGTGG - Intronic
1159935693 18:74365700-74365722 GAATCCGGGGCCGGGCGCGGTGG + Intergenic
1160304314 18:77717653-77717675 GAATGCCGGGGTGGGCAGGGTGG + Intergenic
1160681629 19:414083-414105 GAATTGCGGGGAGGGCAAGGAGG - Intergenic
1161255301 19:3305456-3305478 GAATTACTGGCCGGGCGCGGTGG + Intergenic
1161289586 19:3485925-3485947 GCCTTCCCGGGCGGGCGTGGTGG + Intergenic
1161332850 19:3696597-3696619 GCATTCCGGGGTGGGGGTGGGGG + Intronic
1161521639 19:4727517-4727539 GTATTCTAGGCCGGGCGAGGTGG + Intergenic
1161694705 19:5759786-5759808 GAGTCCCGGGCCGGGCGCGGTGG + Intronic
1161878727 19:6932179-6932201 AAATTCTGGGCCGGGCGTGGTGG + Intronic
1162334407 19:10051609-10051631 GAATACCGGGGGGGGGGGGGGGG - Intergenic
1162377875 19:10315888-10315910 CACTTCCGGGTCGGGGGAGGGGG - Exonic
1162391265 19:10391459-10391481 GAAGTCAGGAGCGGGCGAGATGG + Exonic
1163081810 19:14949731-14949753 GAATTCAGGGTTGGGCGTGGTGG - Intergenic
1163120088 19:15212188-15212210 CACTTCAGGGCCGGGCGAGGTGG + Intergenic
1163123631 19:15232587-15232609 CAATTCCGGGCCGGGTGCGGTGG + Intronic
1163181290 19:15605635-15605657 CAATTCAGGGCCGGGCGAGGTGG - Intergenic
1163724952 19:18917648-18917670 GATTTCCTGGCCGGGCGCGGTGG - Intronic
1163786433 19:19277236-19277258 GACCCCCGGGGCGGGCGGGGGGG + Intronic
1163855283 19:19697008-19697030 GAATTCCAGGCTGGGCGCGGTGG - Intergenic
1164839216 19:31380140-31380162 AAATTCGGGGCCGGGCGCGGTGG - Intergenic
1165267450 19:34672962-34672984 GAATTCTGTGGCGGGGGCGGGGG + Intronic
1165461103 19:35944919-35944941 GGGCTCCGGGGCGGGCGGGGCGG - Exonic
1166577521 19:43856306-43856328 GAATGCCTGGCCGGGCGTGGTGG - Intergenic
1166744325 19:45133369-45133391 GAATTCTGGGCCGGGCGCGGTGG - Intronic
1167108372 19:47444504-47444526 AAATGCTGGGGCCGGCGAGGAGG + Intronic
1167682088 19:50929930-50929952 GAATCCAGGGCCGGGCGCGGTGG - Intergenic
1168245666 19:55112180-55112202 GAATGCCGGGGCGGGGTGGGTGG - Intronic
1168560980 19:57382829-57382851 TAATTCTGGGCCGGGCGTGGTGG - Intronic
1168628455 19:57937543-57937565 AACTTCTGGGCCGGGCGAGGTGG - Intergenic
925680894 2:6420378-6420400 GAATTCAGGGCCGGGCGCGGTGG + Intergenic
925959806 2:9003887-9003909 GAAGTCGGGGGCGGGGGATGCGG - Intergenic
926089522 2:10041496-10041518 GAACTCAGGGCCGGGCGCGGTGG - Intergenic
927794502 2:26036371-26036393 GAAGTCTGGGCCGGGCGCGGTGG + Intronic
927900299 2:26814036-26814058 GAATTCCAGGCCGGGCGCGGTGG + Intergenic
927919668 2:26962153-26962175 GAATGCCGGGCCAGGCGCGGTGG + Intergenic
929336349 2:40751315-40751337 TAATTCCCGGCCGGGCGCGGTGG - Intergenic
929808799 2:45170419-45170441 GAGGTGCGGGGCGGGAGAGGCGG + Intergenic
930195691 2:48507652-48507674 GAACTCCGGGCCAGGCGAGGTGG - Intronic
930425517 2:51207592-51207614 GAATGCAGGGCCGGGCGCGGTGG - Intergenic
930441019 2:51405848-51405870 AAATTCTGGGCCGGGCGCGGTGG - Intergenic
930653840 2:53989033-53989055 GAATTACAGGCCGGGCGTGGTGG - Intronic
931049382 2:58393582-58393604 TAATTCCTGGCCGGGCGCGGTGG - Intergenic
931792433 2:65676560-65676582 GAATTGGGGGCCGGGCGCGGTGG + Intergenic
932301570 2:70671050-70671072 GAAATCCAGGGCTGGAGAGGAGG - Intronic
932529773 2:72516526-72516548 GAATTCAGGGCCGGGCGTGGTGG - Intronic
932698747 2:73978751-73978773 AGATTCCGGGGGGGGGGAGGGGG - Intergenic
932726672 2:74185526-74185548 GAAGTCTGGGCCGGGCGCGGTGG - Intergenic
933062016 2:77749651-77749673 AAATTCCTGGCCGGGCGCGGTGG + Intergenic
933125685 2:78602503-78602525 AAATTCTGGGCCGGGCGCGGTGG + Intergenic
933747938 2:85584454-85584476 GAAGCCGGGAGCGGGCGAGGCGG + Exonic
934069039 2:88366765-88366787 GAATGACGGGCCGGGCGCGGTGG + Intergenic
935996039 2:108773932-108773954 GAATTCCTGGCCAGGCGCGGTGG - Intronic
937359002 2:121216103-121216125 GAATTCTGGGCTGGGCGTGGTGG + Intergenic
937950934 2:127387644-127387666 GAAGCCCGGGCCGGGCGGGGTGG + Intronic
938460993 2:131496458-131496480 GAATTGCTGGCCGGGCGTGGTGG + Intergenic
938476878 2:131624086-131624108 GAATTCTGGGCCGGGCACGGTGG + Intergenic
938600948 2:132838342-132838364 GAAATCGGGGCCGGGCGCGGTGG + Intronic
939445104 2:142300117-142300139 GAATTCCCAGGAGGGCGTGGTGG + Intergenic
939629636 2:144516847-144516869 GGATCCCGGGGCGGGGGCGGGGG - Intronic
939925604 2:148170182-148170204 GAATCCCGGGCCGGGCGCGGTGG - Intronic
939965334 2:148605016-148605038 GAATCCTGGGCCGGGCGTGGAGG - Intergenic
940347494 2:152642717-152642739 GAGTTCCTGGCTGGGCGAGGTGG + Intronic
941817607 2:169813414-169813436 GAATTTCAGGCCGGGCGTGGTGG - Intronic
942035775 2:172009328-172009350 AAATTCCAGGCCGGGCGCGGTGG - Intronic
942327769 2:174790058-174790080 GAAATCCGGGCCAGGCGTGGTGG - Intergenic
943120945 2:183734719-183734741 AAATTTCGGGCCGGGCGTGGTGG - Intergenic
943187225 2:184626153-184626175 GAAATCCGGGCCGGGCGCGGTGG - Intronic
943923785 2:193744623-193744645 GAATACCTGGCCGGGCGCGGTGG + Intergenic
945236250 2:207634568-207634590 GAATTACCGGCTGGGCGAGGTGG + Intergenic
945298812 2:208196739-208196761 AAATTCCTGGCCGGGCGCGGTGG - Intergenic
945760713 2:213910773-213910795 GAATTCTTGGCCGGGCGTGGTGG - Intronic
945883239 2:215348673-215348695 GAAATCCTGGCCGGGCGCGGTGG + Intronic
946029512 2:216693468-216693490 GAATTGCGGGGCGGGGGTGGAGG + Intronic
946338378 2:219053603-219053625 GAATCCTGGGCCGGGCGTGGTGG + Intergenic
947323097 2:228944635-228944657 TAATTCAGGGCCGGGCGCGGTGG - Intronic
947552304 2:231055189-231055211 GAATTCCTGGCCGGGCGCGGTGG - Intergenic
947968114 2:234299471-234299493 GAGTTCAGGGCCGGGCGAGGTGG + Intergenic
948583735 2:239005378-239005400 GAAATCTGGGCCGGGCGTGGTGG - Intergenic
1168760485 20:347066-347088 GCAGTTCGGGGCGGGGGAGGGGG - Exonic
1169243288 20:4003254-4003276 AAATTCTGGGCCGGGCGTGGTGG - Intronic
1169424201 20:5483790-5483812 TAAATGCGGGGCGGGCGGGGCGG + Intergenic
1169459828 20:5784735-5784757 TAATTCTGGGCCGGGCGCGGTGG - Intronic
1169938845 20:10915229-10915251 AAATGCCGGGCCGGGCGTGGTGG + Intergenic
1169999875 20:11604031-11604053 TAATTCCTGGCCGGGCGCGGTGG + Intergenic
1170607010 20:17882239-17882261 GAATCCCGGGGCTGGCCAGAGGG + Intergenic
1171498960 20:25578393-25578415 CATTTCAGGGCCGGGCGAGGTGG - Intronic
1172019758 20:31905744-31905766 AAATTCCAGGCCGGGCGCGGTGG + Intronic
1172157189 20:32835891-32835913 AAATTCTGGGCCGGGCGTGGTGG - Intronic
1172283305 20:33723243-33723265 GACTTTCGGGCCGGGCGCGGTGG - Intergenic
1173916363 20:46711144-46711166 TAATTCAGGGCCGGGCGCGGAGG - Intronic
1174445589 20:50588791-50588813 GAATTCTAGGCCGGGCGCGGTGG + Intronic
1174632183 20:51967607-51967629 AAAGTCCGGGCCGGGCGCGGTGG - Intergenic
1174856004 20:54046240-54046262 GAATTCAGGGCCGGGTGCGGTGG + Intronic
1175438983 20:58977503-58977525 GAATTCTGGGCCGGGTGCGGTGG - Intergenic
1175976601 20:62713445-62713467 GAATTCCGGGAAAGGAGAGGCGG + Intronic
1176014578 20:62923459-62923481 GAATTCCCGGCCGGGCATGGTGG - Intronic
1176223741 20:63982455-63982477 AAATTCTGGGCCGGGCGTGGTGG - Intronic
1177859567 21:26437159-26437181 GTGTTTCGGGGAGGGCGAGGTGG + Intergenic
1178433987 21:32541263-32541285 GAAGTCCAGGCCGGGCGCGGTGG + Intergenic
1178457688 21:32771252-32771274 GAATACGGGGGCGGGGGACGGGG + Intronic
1178545049 21:33485993-33486015 GAATTCGAGGCCGGGCGCGGTGG - Intronic
1179661344 21:42877755-42877777 AAATTACGGGCCGGGCGCGGTGG + Intronic
1180993202 22:19951070-19951092 GAAGCCTGGGGCGGGCGCGGTGG + Intronic
1181115030 22:20626899-20626921 GAATTGCTGGCCGGGCGTGGTGG - Intergenic
1181156542 22:20925349-20925371 TAATTCTGGGCCGGGCGTGGTGG + Intronic
1181640826 22:24197326-24197348 AAATTCTGGGCCGGGCGCGGTGG + Intergenic
1182487569 22:30648462-30648484 GAAATCCAGGCCGGGCGCGGTGG + Intronic
1182602838 22:31480468-31480490 ATATTCCTGGGCGGGCGTGGTGG + Intronic
1182932447 22:34188019-34188041 ATATTCCGGGCCGGGCGCGGTGG - Intergenic
1183418158 22:37694652-37694674 GAGTTCCTGGCCGGGCGGGGTGG - Intronic
1183892919 22:40945614-40945636 GAATTCGAGGCCGGGCGCGGTGG - Intergenic
1184151586 22:42642723-42642745 AAATTACTGGCCGGGCGAGGTGG - Intronic
1184540053 22:45116194-45116216 GAATTCCTGGCCGGGCGTGGTGG + Intergenic
1185122891 22:48983339-48983361 GACTTCTGGGCCGGGCGCGGTGG + Intergenic
950272590 3:11630355-11630377 GAGTTCCTGGCCGGGCGTGGTGG + Intronic
950282302 3:11719195-11719217 GAGGCTCGGGGCGGGCGAGGAGG - Intronic
950383123 3:12634436-12634458 GAATTACGGGCCAGGCGCGGTGG - Intronic
950497953 3:13345462-13345484 GAACTGCGGGGCTGGGGAGGAGG + Intronic
950546437 3:13640800-13640822 GATTTCCCGGCCGGGCGCGGTGG + Intergenic
950749687 3:15118872-15118894 GAATTCTGGGCCGGGCGCGGTGG + Intergenic
950922399 3:16707881-16707903 GGATTCCCGGCCGGGCGCGGTGG + Intergenic
951030540 3:17876971-17876993 GAGTTCCAGGCCGGGCGCGGTGG + Intronic
951180060 3:19649206-19649228 CAATTCCCGGCCGGGCGCGGTGG - Intergenic
952371847 3:32730053-32730075 AAATTCTGGGCCGGGCGCGGTGG - Intronic
953109292 3:39918199-39918221 GAAGTCAGGGCCGGGCGCGGTGG - Intronic
953274479 3:41481538-41481560 GCATTCCTGGCCGGGCGCGGTGG + Intronic
954247146 3:49340668-49340690 GAATTCTGCGGTGGGCCAGGTGG - Intronic
955321029 3:57974451-57974473 AAATTCCCGGCCGGGCGTGGTGG + Intergenic
956442075 3:69290274-69290296 GACTTGAGGGGCGGGTGAGGAGG + Intronic
957499183 3:81032005-81032027 AAATTCCCGGCCGGGCGCGGGGG + Intergenic
959371808 3:105536379-105536401 GAATTCTGGGCCGGGCTTGGTGG - Intronic
959404229 3:105940760-105940782 TACTTCCGGGACGGGCGCGGTGG - Intergenic
959449134 3:106478150-106478172 GTATTCTGGGCCGGGCGTGGTGG + Intergenic
960280421 3:115775208-115775230 AAATTCCAGGTCGGGCGCGGTGG - Intergenic
960462449 3:117952616-117952638 GAATTCTAGGCCGGGCGCGGTGG - Intergenic
961778377 3:129306347-129306369 CAAATCCTGGCCGGGCGAGGTGG + Intergenic
962417977 3:135201156-135201178 GGATTGGGGGGCGGGCAAGGAGG + Intronic
962755928 3:138465408-138465430 GACTTCCTGGGCAGGTGAGGAGG + Exonic
963201680 3:142592457-142592479 GAATGGCGGGCCGGGCGCGGTGG - Intergenic
963394364 3:144713962-144713984 GAATTCAAGGCCGGGCGCGGTGG + Intergenic
965687887 3:171324809-171324831 GAACTCAGGGCCGGGCGCGGTGG + Intronic
966635601 3:182129824-182129846 GAATTTAGGGGAGGGCGAGGAGG + Intergenic
966642891 3:182210138-182210160 GAAATCTGGGCCGGGCGTGGTGG - Intergenic
967039428 3:185676388-185676410 GAATTCCAGGCCGGGCGCCGTGG + Intronic
967071983 3:185970266-185970288 AAATTCCCGGCCGGGCGAGGTGG - Intergenic
967402050 3:189074489-189074511 CAATTCTGGGCCGGGCGCGGTGG - Intronic
968168529 3:196489141-196489163 GAATTCCAGGCCGGGCGTGGTGG - Intronic
968571893 4:1346584-1346606 GAATCCCTGGGCGGGCTTGGGGG - Intergenic
968671475 4:1854504-1854526 GAATTGGGGGCCGGGCGCGGTGG + Intronic
969479430 4:7440194-7440216 GAATTAGGGAGCGGGGGAGGAGG + Intronic
970329384 4:14963447-14963469 GAAATCCGGGCCGGGCGCGGTGG - Intergenic
971786514 4:31110626-31110648 GAATACCAGGCCGGGCGCGGTGG + Intronic
972583219 4:40413693-40413715 GAATTCTGGGTCAGGCGCGGTGG + Intergenic
972849026 4:43025687-43025709 GAAGTCAGGGCCGGGCGCGGTGG + Intronic
975143469 4:70940958-70940980 TAATGCCGGGCCGGGCGTGGTGG - Intronic
977849424 4:101807791-101807813 AAATTCAGGGCCGGGCGTGGTGG + Intronic
978733266 4:112056223-112056245 GAATTCTGGGCCAGGCGTGGTGG - Intergenic
978795790 4:112706156-112706178 GCCTTCCGGGGCCGGGGAGGTGG - Intergenic
979313950 4:119237387-119237409 GCATTGCGTGACGGGCGAGGGGG - Intronic
979544189 4:121921233-121921255 GACTTCCTGGCCGGGCGCGGTGG + Intronic
979687308 4:123524969-123524991 GAATTCCAGGCTGGGCGCGGTGG - Intergenic
980973003 4:139584477-139584499 GAATGCCAGGCCGGGCGAGGTGG + Intronic
981550577 4:145937675-145937697 GGAGTCGGGGGCGGGCGAGGCGG - Intronic
983038270 4:162893798-162893820 AAATTCCAGGCCGGGCGCGGTGG - Intergenic
984456391 4:179974663-179974685 AAATTCCTGGCCGGGCGCGGTGG - Intergenic
984908367 4:184649707-184649729 CAAATCCGGGGCGGGGGAGCCGG - Exonic
985259315 4:188100433-188100455 GAATTCTAGGCCGGGCGCGGTGG + Intronic
985262655 4:188129111-188129133 GATTTCTGGGCCGGGCGCGGTGG + Intergenic
985272129 4:188203611-188203633 GAATTATGGGCCGGGCGCGGTGG - Intergenic
985550114 5:528579-528601 GGCGTCCGGGGCGGGCGGGGCGG - Intergenic
985593616 5:777899-777921 GGAGCCCGGGGCGGGGGAGGGGG + Intergenic
987033363 5:13996306-13996328 GAATTCGGGGTCGGGGGTGGCGG - Intergenic
987132407 5:14871839-14871861 GAAATCAGGGGCGGGCGCGGAGG + Intergenic
987135686 5:14897531-14897553 GAAATTCCGGCCGGGCGAGGTGG + Intergenic
988461833 5:31446157-31446179 TAATTCCAGGCCGGGCGTGGTGG + Intronic
988801724 5:34702099-34702121 GAACTCTTGGGCGGGCGTGGTGG - Intronic
989079239 5:37599602-37599624 GAATTTGGGGCCGGGCGTGGTGG + Intronic
989225951 5:39028467-39028489 GAATTCCAGGCCGGGCGCGGTGG - Intronic
989436819 5:41423656-41423678 GAATTTCTGGCCGGGCGTGGTGG + Intronic
990156795 5:52887022-52887044 GAATTTCAGGGAGGCCGAGGCGG - Intronic
990729527 5:58793269-58793291 GAATTCCTGGCCGGGCGCGGTGG + Intronic
991048197 5:62244934-62244956 GGAGTCTTGGGCGGGCGAGGGGG + Intergenic
991299416 5:65114426-65114448 CGATTCCTGGCCGGGCGAGGTGG - Intergenic
991381095 5:66028804-66028826 GGATTCTGGGGCTGGCGGGGTGG - Intronic
991587732 5:68216439-68216461 CCTTCCCGGGGCGGGCGAGGCGG + Intronic
996292954 5:121875748-121875770 GATTTCCTGGCCGGGCGAGGTGG - Intergenic
996448206 5:123583649-123583671 GATTTCTGGGCCGGGCGCGGTGG - Intronic
996926017 5:128827583-128827605 AAATTGCTGGCCGGGCGAGGTGG + Intronic
997124077 5:131208417-131208439 AAATTCCAGGCCGGGCGTGGTGG - Intergenic
998504780 5:142663722-142663744 GAAATCTGGGGCGAGAGAGGTGG - Intronic
998935209 5:147227005-147227027 AATAGCCGGGGCGGGCGAGGGGG - Intergenic
1000039241 5:157472833-157472855 GGGTTCCGGGGCGGGAGAAGGGG - Exonic
1000624541 5:163524195-163524217 AAATTCAGGGCCGGGCGCGGTGG - Intergenic
1001951379 5:175818948-175818970 GAAGTCGGGGCCGGGCGCGGTGG - Intronic
1002562617 5:180092610-180092632 AACTTCCGGGCCGGGCGTGGTGG + Intergenic
1002592803 5:180302940-180302962 GAATTCCAGGCCGGGCGTGGTGG + Intronic
1002613812 5:180437907-180437929 GAGTTTCTGGCCGGGCGAGGTGG + Intergenic
1002629606 5:180562451-180562473 GAAGTCCTGGCCGGGCGCGGTGG + Intronic
1003343395 6:5243058-5243080 GAAATCCTGGCCGGGCGCGGTGG - Intronic
1003773702 6:9336409-9336431 GAACTCCAGGCCGGGCGCGGTGG + Intergenic
1003894818 6:10597440-10597462 CAATTCCTGGCCGGGCGTGGTGG - Intronic
1003907541 6:10715890-10715912 GAATCCAGGGCCGGGCGCGGTGG - Intergenic
1004228626 6:13811628-13811650 GAGTTCTGGGGCAGGTGAGGTGG - Intronic
1004661293 6:17712143-17712165 GAAATCAGGGGCGGGCACGGTGG + Intergenic
1005242249 6:23844452-23844474 TAATTTCGGGCCGGGCGCGGTGG - Intergenic
1006182356 6:32162003-32162025 GCATTACTGGCCGGGCGAGGTGG - Intronic
1006318380 6:33304494-33304516 GAACTCCGGGGTGGCCCAGGGGG - Exonic
1006702624 6:35988196-35988218 GAATTCGGGGCCGGGCACGGTGG - Intronic
1006757369 6:36428157-36428179 AAATTCCTGGCCGGGCGCGGTGG + Intronic
1007884538 6:45211561-45211583 GAATTCTGGGCCAGGCGTGGTGG + Intronic
1008034757 6:46734533-46734555 AAACTCCGGGGCGGGCGCGGTGG + Intronic
1009328227 6:62381163-62381185 GAATTCTTGGCCGGGCGCGGTGG + Intergenic
1009519617 6:64664559-64664581 GAATTTGGGGGCGGGTGAGGAGG - Intronic
1009699396 6:67156460-67156482 GAATACCTGGCCGGGCGCGGTGG - Intergenic
1009963733 6:70555538-70555560 GATTTCCAGGCTGGGCGAGGTGG - Intronic
1010155417 6:72786717-72786739 GAATCCTGGGCCGGGCGCGGTGG + Intronic
1011108656 6:83811924-83811946 GATTTCCAGGCCGGGCGCGGTGG - Intergenic
1012915177 6:105162442-105162464 AAAATGCGGGCCGGGCGAGGTGG + Intronic
1012941570 6:105421244-105421266 TAATTCTGGGCCGGGCGTGGTGG + Intergenic
1013123644 6:107162208-107162230 GAATTCCCGGCCGGGCGCAGTGG + Intronic
1013299171 6:108786982-108787004 CAAGTCCAGGGCGGGCGAGGGGG + Intergenic
1013550445 6:111202599-111202621 GAATTCCTGGCCGAGCGCGGTGG + Intronic
1015112723 6:129611187-129611209 GAAGTCAGGGCCGGGCGTGGTGG - Intronic
1016035018 6:139375378-139375400 GAATTCCAGGGCGCGGGAGCGGG - Intergenic
1016051507 6:139535311-139535333 AAATTCCAGGCCGGGCGTGGTGG + Intergenic
1016098224 6:140064683-140064705 TAATTCCCGGTCGGGCGCGGTGG + Intergenic
1016230388 6:141796506-141796528 AAATTCTGGGCCGGGCGCGGTGG - Intergenic
1016813314 6:148281633-148281655 AAATTCCAGGCCGGGCGCGGTGG + Intronic
1017153072 6:151298504-151298526 GAATTCTTGGCCAGGCGAGGTGG + Intronic
1017632455 6:156410250-156410272 CAATGGCGGGCCGGGCGAGGTGG + Intergenic
1017867753 6:158459141-158459163 GAAGTCCTGGCCGGGCGCGGTGG + Intronic
1017906719 6:158761593-158761615 GCATTCTGGGCCGGGCGTGGTGG - Intronic
1018199948 6:161385213-161385235 TATTTCCCGGCCGGGCGAGGTGG - Intronic
1018450098 6:163899849-163899871 GAAGTCTGGGCCGGGCGTGGTGG + Intergenic
1018537182 6:164833673-164833695 AAATTCTGGGCCGGGCGAGGTGG + Intergenic
1018884631 6:167923910-167923932 GTATTAGGGGCCGGGCGAGGTGG - Intronic
1018970258 6:168523373-168523395 GAATTACTGGCCGGGCGCGGTGG - Intronic
1019094987 6:169572251-169572273 GAATTCTGGGCCGGGCGTGGTGG + Intronic
1020092950 7:5351492-5351514 GAACTCGGGGGAGGGGGAGGAGG + Intronic
1021806160 7:24358138-24358160 GCATTTCGGGGAGGCCGAGGCGG - Intergenic
1022174757 7:27862355-27862377 GACCTCTGGGGCGGGGGAGGCGG - Intronic
1023829958 7:44033370-44033392 GAATTCTAGGCCGGGCGTGGTGG + Intergenic
1024515811 7:50254531-50254553 GGATTCCTGGCCGGGCGCGGTGG + Intergenic
1024637615 7:51303271-51303293 CAATCCCGGGCCGGGCGTGGTGG + Intronic
1025116645 7:56263935-56263957 GCCTTCAGGGCCGGGCGAGGTGG - Intergenic
1025265043 7:57449738-57449760 TAATTCCTGGCCGGGCGCGGTGG - Intergenic
1025796672 7:64744489-64744511 GAATTCAGGGCCGGGTGTGGTGG + Intergenic
1026094512 7:67333133-67333155 AAATTCCTGGCCGGGCGCGGTGG + Intergenic
1026119113 7:67521199-67521221 GAGTTGCTGGCCGGGCGAGGTGG - Intergenic
1026201211 7:68216068-68216090 GCCTTCAGGGCCGGGCGAGGTGG - Intergenic
1026736668 7:72953476-72953498 GAGTTGAGGGGCGGGGGAGGTGG - Intergenic
1026908191 7:74076032-74076054 CAATTCCAGGCCGGGCGCGGTGG + Intergenic
1027107066 7:75411587-75411609 GAGTTGAGGGGCGGGGGAGGTGG + Intergenic
1027401903 7:77817820-77817842 GAGTTCCGGGCCGGGTGCGGTGG + Intronic
1027651338 7:80872514-80872536 GAATTCTCGGCCGGGCGTGGTGG + Intronic
1027840603 7:83305994-83306016 GTATTCTGGGCCAGGCGAGGTGG - Intergenic
1028174873 7:87643812-87643834 GAATTCTTGGCCGGGCGTGGTGG - Intronic
1028522685 7:91749084-91749106 GAATTCTCGGCCGGGCGCGGTGG - Intronic
1029129855 7:98321807-98321829 GAATTCCAGGCCGGGTGTGGTGG + Intronic
1029238695 7:99143668-99143690 GAATTCCGGGGCGGGCGAGGGGG + Intronic
1029253465 7:99252976-99252998 GAATTTCAGGCCAGGCGAGGTGG + Intergenic
1029740272 7:102487642-102487664 GAATTCTAGGCCGGGCGTGGTGG + Intronic
1029758268 7:102586816-102586838 GAATTCTAGGCCGGGCGTGGTGG + Intronic
1029776206 7:102685894-102685916 GAATTCTAGGCCGGGCGTGGTGG + Intergenic
1033216980 7:139500331-139500353 CAATTCCGGGCCGGGCGCAGTGG + Intergenic
1034383827 7:150721521-150721543 GAAGTAAGGGCCGGGCGAGGTGG + Exonic
1034478957 7:151305102-151305124 GAATTCAGTGGCGGATGAGGAGG - Intergenic
1036039360 8:5057738-5057760 GAATACCAGGCCGGGCGCGGTGG - Intergenic
1036662774 8:10718560-10718582 GAATTGCTGGCCGGGCGCGGTGG - Intergenic
1037173937 8:15925221-15925243 AATTTCCGGGCCGGGCGCGGTGG - Intergenic
1037567784 8:20132048-20132070 AAATTCGGGGCCGGGCGCGGCGG - Intergenic
1038550387 8:28462563-28462585 GAATGCGGGGCCGGGCGCGGTGG - Intronic
1040017041 8:42708177-42708199 GGATTCTGGGCCGGGCGTGGTGG + Intronic
1041064050 8:54064125-54064147 GAATTCTGGGCCGGGCGGGGTGG + Intronic
1042461384 8:69073210-69073232 GAAATCCTGGCCGGGCGTGGTGG + Intergenic
1044112034 8:88286856-88286878 GAGTTCCAGGCCGGGCGTGGTGG - Intronic
1045119227 8:99016874-99016896 GAATTCCTGGCCGGGCGCAGTGG - Intronic
1045385803 8:101670038-101670060 GAATTCAAGGGCGGGCGAGTGGG - Intergenic
1045552065 8:103181557-103181579 ATATTCCTGGCCGGGCGAGGTGG - Intronic
1049152235 8:141042508-141042530 GAATTTCAGGCCGGGCGCGGTGG - Intergenic
1049390559 8:142367509-142367531 GGACGCCGGGGCGGGGGAGGGGG + Intronic
1049723529 8:144133452-144133474 TAATCCCGGGGGGGCCGAGGAGG + Intergenic
1049759304 8:144324778-144324800 CAATTCCCGGCCGGGCGCGGTGG + Intronic
1049765765 8:144354553-144354575 GAAGGGCGGGGCGGGGGAGGAGG - Intronic
1050551513 9:6752655-6752677 TAATTCCAGGGAAGGCGAGGTGG - Intronic
1051367704 9:16332895-16332917 GAATTCTGGGCCAGGCGTGGTGG + Intergenic
1051404958 9:16727164-16727186 GAATGCAGGGGCGGGCGCAGAGG + Intronic
1051413304 9:16812919-16812941 AAATTCCTGGCCGGGCGCGGTGG + Intronic
1051526430 9:18049908-18049930 GAAGTCCGGGCCGGGCACGGTGG - Intergenic
1051656378 9:19385773-19385795 TAATTTCTGGCCGGGCGAGGGGG - Intergenic
1052462531 9:28784664-28784686 GAATTGCAGGTCGGGCGCGGTGG + Intergenic
1052748399 9:32464041-32464063 GAATTCTGGGGCGGGGGATGGGG + Intronic
1053096043 9:35329056-35329078 CAATTCGGGGCTGGGCGAGGTGG - Intronic
1053313824 9:37035803-37035825 GCCTCCCGGCGCGGGCGAGGCGG - Intergenic
1054703481 9:68437998-68438020 GAGTTCCTGGCCAGGCGAGGTGG + Intronic
1055436393 9:76296250-76296272 TAAATCCAGGTCGGGCGAGGTGG - Intronic
1056133502 9:83608417-83608439 GCATTCCGGGCCAGGCGCGGTGG + Intergenic
1057169463 9:92952522-92952544 GATTTTCGGGCCGGGCGCGGTGG - Intronic
1058021473 9:100094368-100094390 GTATTCCAGGCCGGGCGTGGTGG + Intronic
1058308826 9:103475386-103475408 GAATTCAGGGCCGGGCACGGTGG - Intergenic
1059165691 9:112074432-112074454 GAAAGCAGGGGCTGGCGAGGGGG - Intronic
1060348157 9:122834762-122834784 GTATTCCGGGCCAGGCGCGGTGG - Intergenic
1060633041 9:125177085-125177107 GAATTCCCGGCCGGGCGCGGTGG + Intronic
1060880319 9:127113501-127113523 GAATGCCGGGGTGGGGGTGGGGG - Intronic
1061484232 9:130912147-130912169 GAATTCCAGGCCGGGCATGGTGG + Intronic
1062179734 9:135184897-135184919 GCATTTCCGGGCGGGCGAGCCGG - Intergenic
1185616953 X:1427835-1427857 GAAGGCCGAGGCGGGAGAGGCGG - Exonic
1185690569 X:2151958-2151980 GTATTCTGGGCCGGGCAAGGTGG + Intergenic
1185829078 X:3281645-3281667 ACAATCCGGGGCGGGGGAGGGGG - Intronic
1186195515 X:7107537-7107559 GAGTTATGGGGCGGGCGCGGTGG + Intronic
1186266891 X:7842980-7843002 GAAGTCGGGGGCGGGGGGGGGGG - Intronic
1186298212 X:8170845-8170867 GAAGTCGGGGGCGGGGGGGGGGG + Intronic
1186300761 X:8197684-8197706 GAACTCTGGGCCGGGCGCGGTGG + Intergenic
1186793612 X:13023251-13023273 GAAGTCTGGGGTGGGGGAGGTGG - Intergenic
1187067733 X:15856455-15856477 GAAATCTGGTGGGGGCGAGGGGG - Intergenic
1187731138 X:22256037-22256059 AAATTCTGGGCCGGGCGCGGTGG - Intergenic
1187928713 X:24274592-24274614 AAATTCAGGGCCGGGCGCGGTGG + Intergenic
1190845022 X:54183283-54183305 GCACTCCGCGGGGGGCGAGGGGG + Intergenic
1192377954 X:70583990-70584012 AAATTCCTGGCCGGGCGCGGTGG + Intronic
1192756497 X:74051392-74051414 GAAATCCGGGCCGGGCATGGTGG + Intergenic
1193753109 X:85372055-85372077 GAATTTGGGGCCGGGCGTGGTGG + Intronic
1193990472 X:88300361-88300383 GTATTCCAGGCCGGGCGCGGTGG - Intergenic
1195082419 X:101384308-101384330 GAATTCCAGGGTGGGTGCGGTGG + Intronic
1195370753 X:104169853-104169875 GAATACTGGGCCGGGCGCGGTGG - Intronic
1195554006 X:106200759-106200781 GAATTGCCGGCCGGGCGCGGTGG + Intronic
1196576030 X:117320391-117320413 AAATTCTGGGCCGGGCGCGGTGG + Intergenic
1196796788 X:119508295-119508317 GAATTCCCGGCCGGGTGTGGTGG - Intergenic
1196798737 X:119523458-119523480 GAGTTCCGGGCCGGGCGTTGTGG - Intergenic
1196804804 X:119574647-119574669 GGTTCCCGCGGCGGGCGAGGAGG - Exonic
1198082612 X:133253336-133253358 GCATTCTGGGCCGGGCGTGGTGG + Intergenic
1199199627 X:145071725-145071747 GAAATCCTGGCCGGGCGCGGTGG - Intergenic
1200128469 X:153829210-153829232 GAACTCCGGGGCGGGGGCGGGGG - Intronic
1200138777 X:153887062-153887084 GAATTCCGGAGCCGGCGAGCTGG + Intronic
1201438887 Y:13986642-13986664 GAAGTCGGGGGCGGGGGGGGGGG + Intergenic
1201445686 Y:14056066-14056088 GAAGTCGGGGGCGGGGGGGGGGG - Intergenic
1201548072 Y:15188653-15188675 GAATACTGGGCCGGGCGCGGTGG + Intergenic