ID: 1029238834

View in Genome Browser
Species Human (GRCh38)
Location 7:99144158-99144180
Sequence GCGCGCACGCACGCAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029238834_1029238846 2 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238846 7:99144183-99144205 CCGCCACGTACGCTGGGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
1029238834_1029238849 6 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238849 7:99144187-99144209 CACGTACGCTGGGGCGGGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 166
1029238834_1029238842 0 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238834_1029238848 5 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238848 7:99144186-99144208 CCACGTACGCTGGGGCGGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 122
1029238834_1029238837 -5 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238837 7:99144176-99144198 CGCGCCCCCGCCACGTACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1029238834_1029238844 1 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238844 7:99144182-99144204 CCCGCCACGTACGCTGGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1029238834_1029238839 -3 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238839 7:99144178-99144200 CGCCCCCGCCACGTACGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 55
1029238834_1029238850 7 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238850 7:99144188-99144210 ACGTACGCTGGGGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 200
1029238834_1029238838 -4 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238838 7:99144177-99144199 GCGCCCCCGCCACGTACGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029238834 Original CRISPR GCGCGCACGCACGCAGGCGC GGG (reversed) Intergenic