ID: 1029238842

View in Genome Browser
Species Human (GRCh38)
Location 7:99144181-99144203
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029238835_1029238842 -1 Left 1029238835 7:99144159-99144181 CCGCGCCTGCGTGCGTGCGCGCC 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238829_1029238842 15 Left 1029238829 7:99144143-99144165 CCGGCCCTGCGCGCCCCCGCGCC 0: 1
1: 2
2: 20
3: 160
4: 942
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238832_1029238842 2 Left 1029238832 7:99144156-99144178 CCCCCGCGCCTGCGTGCGTGCGC 0: 1
1: 1
2: 1
3: 14
4: 92
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238825_1029238842 28 Left 1029238825 7:99144130-99144152 CCGCCGTGCCGGCCCGGCCCTGC 0: 1
1: 1
2: 5
3: 59
4: 609
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238833_1029238842 1 Left 1029238833 7:99144157-99144179 CCCCGCGCCTGCGTGCGTGCGCG 0: 1
1: 0
2: 3
3: 27
4: 111
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238830_1029238842 11 Left 1029238830 7:99144147-99144169 CCCTGCGCGCCCCCGCGCCTGCG 0: 1
1: 0
2: 0
3: 28
4: 259
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238836_1029238842 -6 Left 1029238836 7:99144164-99144186 CCTGCGTGCGTGCGCGCCCCCGC 0: 1
1: 1
2: 3
3: 21
4: 153
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238826_1029238842 25 Left 1029238826 7:99144133-99144155 CCGTGCCGGCCCGGCCCTGCGCG 0: 1
1: 0
2: 5
3: 23
4: 396
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238831_1029238842 10 Left 1029238831 7:99144148-99144170 CCTGCGCGCCCCCGCGCCTGCGT 0: 1
1: 0
2: 1
3: 21
4: 285
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238834_1029238842 0 Left 1029238834 7:99144158-99144180 CCCGCGCCTGCGTGCGTGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238827_1029238842 20 Left 1029238827 7:99144138-99144160 CCGGCCCGGCCCTGCGCGCCCCC 0: 1
1: 1
2: 26
3: 218
4: 1346
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1029238828_1029238842 16 Left 1029238828 7:99144142-99144164 CCCGGCCCTGCGCGCCCCCGCGC 0: 1
1: 1
2: 9
3: 89
4: 733
Right 1029238842 7:99144181-99144203 CCCCGCCACGTACGCTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029238842 Original CRISPR CCCCGCCACGTACGCTGGGG CGG Intergenic