ID: 1029243042

View in Genome Browser
Species Human (GRCh38)
Location 7:99178073-99178095
Sequence GTCTCATGTCCCCTTGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243042_1029243046 -3 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243046 7:99178093-99178115 GACCCCCGGCAGGAGCCTTTGGG 0: 1
1: 0
2: 1
3: 10
4: 96
1029243042_1029243045 -4 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243045 7:99178092-99178114 AGACCCCCGGCAGGAGCCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 132
1029243042_1029243054 5 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243054 7:99178101-99178123 GCAGGAGCCTTTGGGGGATAGGG 0: 1
1: 0
2: 2
3: 20
4: 202
1029243042_1029243049 -1 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243049 7:99178095-99178117 CCCCCGGCAGGAGCCTTTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 155
1029243042_1029243053 4 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243053 7:99178100-99178122 GGCAGGAGCCTTTGGGGGATAGG 0: 1
1: 0
2: 3
3: 36
4: 299
1029243042_1029243056 24 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243056 7:99178120-99178142 AGGGACTCTGTCAGCCCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 194
1029243042_1029243047 -2 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243047 7:99178094-99178116 ACCCCCGGCAGGAGCCTTTGGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1029243042_1029243057 25 Left 1029243042 7:99178073-99178095 CCAAGTACAAGGGGACATGAGAC 0: 1
1: 0
2: 0
3: 23
4: 107
Right 1029243057 7:99178121-99178143 GGGACTCTGTCAGCCCTCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243042 Original CRISPR GTCTCATGTCCCCTTGTACT TGG (reversed) Intronic