ID: 1029243048

View in Genome Browser
Species Human (GRCh38)
Location 7:99178095-99178117
Sequence CCCCCAAAGGCTCCTGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243048_1029243060 18 Left 1029243048 7:99178095-99178117 CCCCCGGCAGGAGCCTTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150
1029243048_1029243056 2 Left 1029243048 7:99178095-99178117 CCCCCGGCAGGAGCCTTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1029243056 7:99178120-99178142 AGGGACTCTGTCAGCCCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 194
1029243048_1029243057 3 Left 1029243048 7:99178095-99178117 CCCCCGGCAGGAGCCTTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1029243057 7:99178121-99178143 GGGACTCTGTCAGCCCTCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243048 Original CRISPR CCCCCAAAGGCTCCTGCCGG GGG (reversed) Intronic