ID: 1029243050

View in Genome Browser
Species Human (GRCh38)
Location 7:99178096-99178118
Sequence TCCCCCAAAGGCTCCTGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243050_1029243060 17 Left 1029243050 7:99178096-99178118 CCCCGGCAGGAGCCTTTGGGGGA 0: 1
1: 0
2: 1
3: 16
4: 121
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150
1029243050_1029243057 2 Left 1029243050 7:99178096-99178118 CCCCGGCAGGAGCCTTTGGGGGA 0: 1
1: 0
2: 1
3: 16
4: 121
Right 1029243057 7:99178121-99178143 GGGACTCTGTCAGCCCTCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1029243050_1029243056 1 Left 1029243050 7:99178096-99178118 CCCCGGCAGGAGCCTTTGGGGGA 0: 1
1: 0
2: 1
3: 16
4: 121
Right 1029243056 7:99178120-99178142 AGGGACTCTGTCAGCCCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243050 Original CRISPR TCCCCCAAAGGCTCCTGCCG GGG (reversed) Intronic