ID: 1029243052

View in Genome Browser
Species Human (GRCh38)
Location 7:99178098-99178120
Sequence TATCCCCCAAAGGCTCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243052_1029243057 0 Left 1029243052 7:99178098-99178120 CCGGCAGGAGCCTTTGGGGGATA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1029243057 7:99178121-99178143 GGGACTCTGTCAGCCCTCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1029243052_1029243056 -1 Left 1029243052 7:99178098-99178120 CCGGCAGGAGCCTTTGGGGGATA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1029243056 7:99178120-99178142 AGGGACTCTGTCAGCCCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 194
1029243052_1029243063 29 Left 1029243052 7:99178098-99178120 CCGGCAGGAGCCTTTGGGGGATA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029243052_1029243060 15 Left 1029243052 7:99178098-99178120 CCGGCAGGAGCCTTTGGGGGATA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243052 Original CRISPR TATCCCCCAAAGGCTCCTGC CGG (reversed) Intronic