ID: 1029243055

View in Genome Browser
Species Human (GRCh38)
Location 7:99178108-99178130
Sequence ACAGAGTCCCTATCCCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243055_1029243063 19 Left 1029243055 7:99178108-99178130 CCTTTGGGGGATAGGGACTCTGT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029243055_1029243060 5 Left 1029243055 7:99178108-99178130 CCTTTGGGGGATAGGGACTCTGT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150
1029243055_1029243057 -10 Left 1029243055 7:99178108-99178130 CCTTTGGGGGATAGGGACTCTGT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1029243057 7:99178121-99178143 GGGACTCTGTCAGCCCTCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243055 Original CRISPR ACAGAGTCCCTATCCCCCAA AGG (reversed) Intronic