ID: 1029243058

View in Genome Browser
Species Human (GRCh38)
Location 7:99178134-99178156
Sequence ACTCGGGGCAGCTCCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243058_1029243063 -7 Left 1029243058 7:99178134-99178156 CCCTCAAGGGAGCTGCCCCGAGT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1029243063 7:99178150-99178172 CCCGAGTGGAAGCAGACCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029243058_1029243066 10 Left 1029243058 7:99178134-99178156 CCCTCAAGGGAGCTGCCCCGAGT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1029243066 7:99178167-99178189 CAAAGGCTACCATTCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029243058 Original CRISPR ACTCGGGGCAGCTCCCTTGA GGG (reversed) Intronic