ID: 1029243060

View in Genome Browser
Species Human (GRCh38)
Location 7:99178136-99178158
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029243050_1029243060 17 Left 1029243050 7:99178096-99178118 CCCCGGCAGGAGCCTTTGGGGGA 0: 1
1: 0
2: 1
3: 16
4: 121
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150
1029243051_1029243060 16 Left 1029243051 7:99178097-99178119 CCCGGCAGGAGCCTTTGGGGGAT 0: 1
1: 0
2: 1
3: 37
4: 170
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150
1029243048_1029243060 18 Left 1029243048 7:99178095-99178117 CCCCCGGCAGGAGCCTTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150
1029243055_1029243060 5 Left 1029243055 7:99178108-99178130 CCTTTGGGGGATAGGGACTCTGT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150
1029243052_1029243060 15 Left 1029243052 7:99178098-99178120 CCGGCAGGAGCCTTTGGGGGATA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1029243060 7:99178136-99178158 CTCAAGGGAGCTGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type