ID: 1029243061 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:99178149-99178171 |
| Sequence | CTTTGGTCTGCTTCCACTCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 271 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 35, 4: 234} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029243061_1029243069 | 25 | Left | 1029243061 | 7:99178149-99178171 | CCCCGAGTGGAAGCAGACCAAAG | 0: 1 1: 0 2: 1 3: 35 4: 234 |
||
| Right | 1029243069 | 7:99178197-99178219 | CAATTTCACTTTTCCCAAATTGG | 0: 1 1: 0 2: 1 3: 40 4: 313 |
||||
| 1029243061_1029243066 | -5 | Left | 1029243061 | 7:99178149-99178171 | CCCCGAGTGGAAGCAGACCAAAG | 0: 1 1: 0 2: 1 3: 35 4: 234 |
||
| Right | 1029243066 | 7:99178167-99178189 | CAAAGGCTACCATTCCAGAATGG | 0: 1 1: 0 2: 1 3: 18 4: 263 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029243061 | Original CRISPR | CTTTGGTCTGCTTCCACTCG GGG (reversed) | Intronic | ||